A food-grade industrial arming yeast expressing β-1,3-1,4-glucanase with enhanced thermal stability

A food-grade industrial arming yeast expressing β-1,3-1,4-glucanase with enhanced thermal stability 1 first-author 2 1 1 1 1 1 corresp ‡Corresponding Authors ‡Corresponding Authors †E-mail:ruanhui98@yahoo.com.cngqhe@zju.edu.cn †E-mail:ruanhui98@yahoo.com.cngqhe@zju.edu.cn ruanhui98@yahoo.com.cn 1 corresp ‡Corresponding Authors ‡Corresponding Authors †E-mail:ruanhui98@yahoo.com.cngqhe@zju.edu.cn †E-mail:ruanhui98@yahoo.com.cngqhe@zju.edu.cn ruanhui98@yahoo.com.cn Department of Food Science and Nutrition, Zhejiang University, Hangzhou 310029, China Department of Food Science and Nutrition, Zhejiang University, Hangzhou 310029, China Wenzhou Medical College, Wenzhou 325035, China Wenzhou Medical College, Wenzhou 325035, China The aim of this work was to construct a novel food-grade industrial arming yeast displaying β-1,3-1,4-glucanase and to evaluate the thermal stability of the glucanase for practical application. For this purpose, a bi-directional vector containing galactokinase ( GAL1 ) and phosphoglycerate kinase 1 ( PGK1 ) promoters in different orientations was constructed. The β-1,3-1,4-glucanase gene from Bacillus subtilis was fused to α-agglutinin and expressed under the control of the GAL1 promoter. α-galactosidase induced by the constitutive PGK1 promoter was used as a food-grade selection marker. The feasibility of the α-galactosidase marker was confirmed by the growth of transformants harboring the constructed vector on a medium containing melibiose as a sole carbon source, and by the clear halo around the transformants in Congo-red plates owing to the expression of β-1,3-1,4-glucanase. The analysis of β-1,3-1,4-glucanase activity in cell pellets and in the supernatant of the recombinant yeast strain revealed that β-1,3-1,4-glucanase was successfully displayed on the cell surface of the yeast. The displayed β-1,3-1,4-glucanase activity in the recombinant yeast cells increased immediately after the addition of galactose and reached 45.1 U/ml after 32-h induction. The thermal stability of β-1,3-1,4-glucanase displayed in the recombinant yeast cells was enhanced compared with the free enzyme. These results suggest that the constructed food-grade yeast has the potential to improve the brewing properties of beer. α-agglutinin Food-grade selection marker β-1,3-1,4-glucanase α-galactosidase Thermostability Introduction 1 β-glucan is one of the major components of the cell wall in the main cereal grains such as barley and oats (Vis and Lorenz, 1997 1997 ). During the brewing process, high concentrations of β-glucan resulting from improper malting or poor quality barley lead to high viscosity of beer, the formation of gelatinous precipitate, a reduction of the extract yield, and decreasing run-off of wort (Bamforth, 1994 1994 ). Problems associated with β-glucan in beer can be alleviated by the application of commercial β-1,3-1,4-glucanase during malt production, fermentation, or lagering. β-1,3-1,4-glucanase belongs to the glycosyl hydrolases family 16 with strict cleavage specificity for β-1,4-linkages adjacent to β-1,3-linkages, yielding 63.5% cellotriose and 29.5% cellotetraose as the major products when β-glucans are used as substrate (Bielecki and Galas, 1991 1991 ; Tsai et al., 2005 2005 ). Traditionally, β-1,3-1,4-glucanase is made by separation and purification from natural sources, such as Penicillium emersonii , Aspergillus niger , Bacillus subtilis , and Trichoderma reesei (Harman and Kubicek, 1998 1998 ). Recently, a recombinant β-1,3-1,4-glucanase gene has been successfully expressed in a number of microorganisms, including Lactococcus lactis (Li et al., 2009 2009 ), Escherichia coli (Teng et al., 2006 2006 ; Qiao et al., 2009 2009 ), Pichia pastoris (Teng et al., 2007 2007 ), and Saccharomyces cerevisiae (Hinchliffe and Box, 1984 1984 ; van Rensburg et al., 1997 1997 ; Zhang Q. et al., 2008 2008 ). However, the free enzyme preparation involving multiple processing steps is time-consuming and costly. In the brewing industry, a less-costly solution is to use yeast strains producing β-1,3-1,4-glucanase. Considering the lower fermentation performance and stability of laboratory haploid yeasts, industrial yeast strains are preferred as hosts for expression of β-1,3-1,4-glucanase genes (John, 1995 1995 ). However, with industrial yeast strains it is difficult to choose a suitable selection marker for transformation because the introduction of auxotrophic mutations into polyploid yeast strains is neither practicable nor desirable. Also, the presence of auxotrophic markers in transformants has strong deleterious effects on the production levels of the desired heterologous proteins (Pronk, 2002 2002 ). While antibiotic resistance markers can provide good selection independent of yeast genotypes, their presence is an undesirable trait in beer products. Therefore, a new dominant marker, safe and selective against a wild-type polyploid background, is required. Melibiose can be hydrolyzed into galactose and glucose by α-galactosidase (EC 3.2.1.22) encoded by the MEL1 gene (Ruohola et al., 1986 1986 ). Various food-grade expression systems based on melibiose fermentation have been reported for L . lactis (Boucher et al., 2002 2002 ; Jeong et al., 2006 2006 ) and Streptococcus thermophilus (Labrie et al., 2005 2005 ). However, melibiose is not commonly used as a substrate for the industrial yeast S . cerevisiae , because only a few Saccharomyces strains, such as Saccharomyces bayanus var. uvarum , carlsbergensis , and oleaginosus , are Mel -positive. Therefore, the construction of a novel food-grade vector harboring a dominant marker based on the phenotype of fermenting melibiose is an attractive option for the industrial yeast S . cerevisiae . The lack of thermal stability of the recombinant β-1,3-1,4-glucanase is also a bottleneck for its application in the beer industry. As a consequence, the surface-display production of β-1,3-1,4-glucanase in yeast becomes more attractive. Unlike secreted enzymes, such displayed enzyme is readily produced at a low cost and is “naturally” immobilized onto the cell surface. Therefore, no tedious purification or immobilization processing is required (Murai et al., 1997 1997 ). Moreover, such immobilization offers enzymes a physical support that often improves thermostability and facilitates reusability (Shusta et al., 1999 1999 ; Park et al., 2006 2006 ; Tanino et al., 2006 2006 ; Gai and Wittrup, 2007 2007 ). In this paper, we report the development and evaluation of a novel food-grade industrial arming yeast displaying β-1,3-1,4-glucanase using α-galacto-sidase as a selection marker. The thermostability of β-1,3-1,4-glucanase displayed on the cell surface of yeast cells was successfully improved. This work is of value to the beer industry and to biocatalysic processes involving the expression of other related enzymes. Materials and methods 1 Strains, plasmids, and growth conditions 2 E . coli DH5α was used for the maintenance and manipulation of plasmids. Industrial brewer’s yeast MS-1 (preserved in our laboratory) was used as the host strain for the cell-surface display system. B . subtilis mutant ZJF-1A5 and wild-type S . bayanus var. uvarum (preserved in our laboratory) were the donor strains for the β-1,3-1,4-glucanase gene and α-galactosidase gene, respectively. Plasmid YEPlac181 (Gietz and Sugino, 1988 1988 ) was a generous gift from Prof. R. Daniel Gietz (University of Manitoba, Canada) and was used as a backbone vector. E . coli was grown in Luria-Bertani (LB) medium (0.5% (w/v) yeast extract, 1% (w/v) sodium chloride, and 1% (w/v) tryptone; pH 7.0) at 37 °C with 100 μg/ml ampicillin when necessary. Yeast cells were cultured in YP medium (1% (w/v) bacto-peptone and 2% (w/v) yeast extract) supplemented with either 2% (w/v) glucose (YPD) or 3% (v/v) glycerol and 2% (v/v) lactic acid (YPGL) (Tuan, 1997 1997 ). Using α-galactosidase as a selection marker, yeasts harboring the vector were selected on MSD medium (0.17% (w/v) yeast nitrogen base without amino acids and 0.5% (w/v) ammonium sulfate) supplemented with 2% (w/v) melibiose or on the YPD plate containing X-α-gal (5-bromo-4-chloro-3-indolyl-α-D-galactopyranoside; 4 mg/ml) at 30 °C. For solid media, 2% (w/v) agar was added. Polymerase chain reaction (PCR) and DNA technique 2 The PGK1 promoter ( PGK1 P ), the GAL1 promoter ( GAL1 P ), the prepro-secretion signal sequence of the mating factor α 1 ( MFα1 ), the α-agglutinin gene containing the 3′ half of the region encoding 320 amino acids and a 238 bp flanking region, and the alcohol dehydrogenase ( ADH1 ) terminator ( ADH1 T ) were amplified by PCR using MS-1 genomic DNA as the template (their corresponding primers shown in Table 1 1 ), with the relevant restriction enzyme recognition sites added to the primers in 5′-ends and 3′-ends. The α-galactosidase and β-1,3-1,4-glucanase genes were amplified using S . bayanus var. uvarum genomic DNA and B . subtilis ZJF-1A5 genomic DNA as the templates (Table 1 1 ), respectively. Underlines indicate the restriction sites for the fragments Primer Sequence (5′→3′) a a Restriction site  GAL1 P -S1 GGC AAGCTT TAGTACGGATTAGAAGCC Hin dIII  GAL1 P -AS1 GGC GCATGC TCTCCTTGACGTTAAAGT Sph I  MFα1-S1 GCG GCATGC AGAATGAGATTTC CTTC Sph I  MFα1-AS1 TA GGTACCCCGCGGCCATGGGCTAGC TTCAGCCTCTCTTTTA Kpn I, Sac II, Nco I, Nhe I  α-agglutinin-S1 TCC CCGCGG AGCGCCAAAAGCTCTTTTATC Sac II  α-agglutinin-AS1 GC GGTACC TAATGAAACGAGCGGTAACG Kpn I  ADH1 T -S1 GG GGTACC GCGAATTTCTTATG Kpn I  ADH1 T -AS1 GG GAATTC GCATATCTACAATTGGG Eco RI  PGK1 P -S1 CGG AAGCTT GACGTCCTTCAACTCAAGACGCACAG Aat II  PGK1 P -AS1 GGC GTCGAC TGTTTTATATTTGTTGTAAAAAGTAG Sal I  Mel1-S1 GGC GTCGAC ATGTTTGCTTTATACTTTCTCA Sal I  Mel1-AS1 GGCGGTACC ATCGAT CGAGTTTCTCAGAGTGCTTGGT Cla I The PCR mixture (50 μl), prepared according to the instructions of the manufacturer of PrimeSTAR HS DNA polymerase (Takara, Kyoto, Japan), was incubated at 94 °C for 5 min and the reaction was then run at 98 °C for 10 s, 58 °C for 15 s, and 72 °C for 3 min for 31 cycles. All PCR products were purified and sequenced (Shanghai Sangon Co., Shanghai, China). Plasmid construction 2 The fragment GAL1 P was fused to the MFα1 signal peptide sequence containing a multiple cloning site (MCS; Nhe I, Nco I, Sac II, and Kpn I) in vitro after the Sph I digestion. The fused fragment was digested with Hin dIII and Kpn I and then inserted into the Hin dIII/ Kpn I site of YEp181, forming the plasmid YGM. The α-agglutinin and ADH1 T gene fragments were digested with Kpn I and ligated to produce the fusion fragment NA. YGMNA was constructed by cloning the fragment NA into Sac II /Eco RI site of YGM. The MEL1 gene fragment encoding α-galactosidase was amplified, digested with Sal I, and was then ligated with PGK1 P fragments digested with the same enzyme to obtain the fusion fragment PM. The PM fragment was digested with Aat II and Cla I, and inserted into the same site of YGMNA, resulting in the plasmid YGMNA-PM. The gene encoding β-1,3-1,4-glucanase derived from B . subtilis mutant ZJF-1A5 was digested with Nhe I and Sac II, and then introduced into the YGMNA-PM vector to generate plasmid YGMPNA-PM-a. Finally, the Amp R gene of YGMPNA-PM-a was removed by double digestion of Aat II and Hin dIII. The final construct of YGMPNA-PM was obtained (Fig. 1 1 ). Yeast transformation 2 Yeasts were transformed by electroporation (Thompson et al., 1998 1998 ). Selection and maintenance of the transformants were carried out on MSD medium. α-galactosidase assay 2 α-galactosidase activity in the supernatants was determined by the method of McCleary ( 1988 1988 ). p -nitrophenyl-α-D-galactopyranoside (PNPG) was used as a substrate. One unit of enzyme activity was defined as the amount of enzyme that releases 1 nmol of p -nitrophenol from the substrate per minute. Cultivation and induction conditions for cell-surface display expression 2 Transformants were preincubated in 5 ml of YPD medium overnight at 30 °C with shaking at 180 r/min, and the 5-ml culture was used as a starter to inoculate 50 ml of YPGL medium in a 250-ml baffle flask. At optical density at 600 nm (OD 600 ) close to 2.0, galactose was added to 2% (w/v) final concentration. Identification of the expression of β-1,3-1,4-glucanase in plate assay 2 A two-layer detection plate was used to identify the expression of the β-1,3-1,4-glucanase gene. The transformants were inoculated on YPG plates (1% (w/v) bacto-peptone, 2% (w/v) yeast extract, and 3% (v/v) glycerol). After 24 h, the YPG plates were covered with 5 ml of 0.5% (w/v) agar solution containing 0.1% (w/v) lichenan and 2% (w/v) galactose to induce the expression of the β-1,3-1,4-glucanase gene. After an induction at 30 °C for 20 h, the plates were stained with 0.1% (w/v) Congo-red solution until halos appeared. Colonies that formed clear halos were the recombinant yeasts expressing the β-1,3-1,4-glucanase gene (Zhang Q. et al., 2008 2008 ). Preparation of β-1,3-1,4-glucanase-displaying yeast cells 2 To prepare the β-1,3-1,4-glucanase-displaying yeast cells, 2 ml of culture broth was collected at various time points after induction and centrifuged at 10 000× g at 4 °C for 3 min. The pellet was washed with distilled water twice and resuspended in 400 μl of 0.05 mol/L sodium acetate buffer (pH 6.0) to give an OD 600 of 2 for further use. Assay of surface-displayed β-1,3-1,4-glucanase activity 2 The activity of β-1,3-1,4-glucanase was determined by the Congo-red method (van Rensburg et al., 1997 1997 ). Barley β-glucan, used as the substrate in this assay, was dissolved in 0.05 mol/L sodium acetate (pH 6.0) to obtain a final concentration of 100 μg/ml. The reaction mixture, with a total volume of 1 ml, contained 400 μl of the yeast cell suspension and 600 μl of the substrate solution. The mixture was incubated at 50 °C at pH 6.0 for 1 h, heated at 100 °C for 10 min, and then cooled to room temperature. The supernatant was separated by centrifugation at 10 000× g at 4 °C for 3 min. One millilitre of Congo-red (100 μg/ml) was added to the supernatant. Absorbance of the supernatant was measured at OD 540 (Wood et al., 1988 1988 ). One unit of β-1,3-1,4-glucanase activity was defined as the amount of enzyme required to hydrolyze 1 μg β-glucan per hour at 50 °C and pH 6.0. High performance liquid chromatography (HPLC) analysis of galactose concentration 2 The concentration of galactose was determined by HPLC. One millilitre of sample was taken out of the culture broth and immediately filtered through a cellulose acetate filter with 0.45-mm pores. The filtrate was frozen and kept at −20 °C until analyzed. HPLC analysis of galactose was performed using a Waters 2410 RI detector. The HPLC apparatus was operated at 90 °C with 0.1 mmol/L Ca-ethylenediamine tetraacetic acid (EDTA) solution at a flow rate of 0.25 ml/min as the mobile phase. Waters Sugar PAK-I columns, 6.5 mm×300 mm, were used for the separation. Measurement of thermal stability of β-1,3-1,4-glucanase in yeast cells 2 Yeast cells harvested from culture broth were washed with distilled water twice and resuspended in 0.05 mol/L sodium acetate (pH 6.0). The suspension was then incubated at 50, 60 and 70 °C for 1–3 h. Periodically, aliquots of cell suspensions were taken and immediately cooled on ice. The residual β-1,3-1,4-glucanase activity was measured as described above. The percentage of residual β-1,3-1,4-glucanase activity was calculated by dividing the enzyme activity after incubation by the initial enzyme activity and then multiplying by 100. The thermal stability of free β-1,3-1,4-glucanase was also measured. Plasmid stability 2 A single yeast colony was used to inoculate the YPD medium. Yeast cells were diluted with distilled water and plated onto YPD and MSD plates every 24 h. After incubation at 30 °C for 48 h, the numbers of colonies on the plates were counted. Plasmid stability ( X ) was determined by comparing the number of colonies on the YPD plate ( A ) with that on the MSD plate ( B ), i.e., X (%)= B ×100/ A . Results 1 Construction and characterization of the food-grade vector YGMPNA-PM 2 The vector YGMPNA-PM was designed according to bi-directional vectors (Miller III et al., 1998 1998 ; Li et al., 2008 2008 ) which allowed for the expression of two genes under the control of GAL1 P and PGK1 P in different orientations. Three restriction sites, Nhe I, Nco I, and Sac II, were introduced into YEPlac181 for easy manipulation. β-l,3-1,4-glucanases from barley and B . subtilis have similar substrate specificities for β-glucan and lichenan (Muller et al., 1998 1998 ). In this study, the β-1,3-1,4-glucanase gene from B . subtilis mutant ZJF-1A5 was cloned and put under the control of GAL1 P and MFα1 . To display the enzyme, the C-terminal half of α-agglutinin was used as a surface anchor for target proteins. In comparison with the published α-agglutinin sequence, 7 nucleotide mutations were found in the open reading frame (ORF) of our α-agglutinin gene sequence, which led to the changes of 5 amino acid sequences (data not shown). The MEL1 gene from S . bayanus var. uvarum was fused to the constitutive PGK1 P to form the food-grade selection module in yeast. The final vector YGMPNA-PM was constructed as described in the Section 2.3 (Fig. 1 1 ). Evaluation of MEL1 as a food-grade selection marker in industrial yeasts 2 It is well known that the industrial S . cerevisiae strains are recalcitrant to the uptake of exogenous DNA (Navas et al., 1991 1991 ). When α-galactosidase was adopted as a marker for positive selection of yeast transformants, the transformation efficiency was 10–20 transformants per μg of DNA, which was much lower than that of laboratory haploid yeast strains (50–70 transformants per μg of DNA). The expression of the MEL1 gene gave the industrial yeast the ability to ferment melibiose. As a result, the transformants carrying vector YGMPNA-PM could grow in the minimum media containing melibiose as a sole carbon source. The transformants were also easily detected by the appearance of a blue colony on the X-α-gal-containing medium owing to the expression of MEL1 . The growth of S . cerevisiae /YGMPNA-PM cells in MSD medium was monitored by determining the OD 600 of the culture broth. After being grown in MSD for 160 h, the absorbance of S . cerevisiae /YGMPNA-PM at 600 nm was able to reach about 16 (Fig. 2 2 ). However, no growth was observed in the control strain harboring YEPlac181. The data points represent the average of three independent experiments Fig. 3 3 shows a comparison of α-galactosidase activity of S . cerevisiae /YGMPNA-PM between different cultivation modes (MSD and YPD). The α-galactosidase activity in both cultivation modes increased with the cultivation time. The enzyme activity reached its maximum at 44 h in YPD medium (104.38 U/ml) and at 116 h in MSD medium (41.72 U/ml). The peak enzyme activity in YPD medium was 2.5 times higher than that in MSD medium, which is likely to have resulted from the differences in nutrients between these two media. The α-galactosidase activity in YPD medium then decreased but almost remained constant in MSD medium. The plasmid stability in the cells cultivated in YPD and MSD media at 116 h was about 60% and 95%, respectively (data not shown). The data points represent the average of three independent experiments After the transformants were obtained on MSD plates using α-galactosidase as the selection marker, we performed a plate assay to determine whether the transformants gained β-1,3-1,4-glucanase activity. A two-layer detection plate was used to identify the expression of the β-1,3-1,4-glucanase gene as described above. The desired S . cerevisiae /YGMPNA-PM transformants were preliminarily identified by the formation of halos strictly around colonies grown on the YP plates. Clear halos reflected the degradation of lichenan owing to the expression of the β-1,3-1,4-glucanase gene (Fig. 4 4 ). No halos were observed around the control strain/YEPlac181. Thus, the use of α-galactosidase as the selection marker was proved to be effective, and the resultant yeast strains/YGMPNA-PM could be called food-grade yeast. Cells were grown on YPG plate at 30 °C for 24 h. The YPG plate was then covered with 5 ml of 0.5% (w/v) agar solution containing 0.1% (w/v) lichenan and 2% (w/v) galactose to induce the expression of β-1,3-1,4-glucanase. β-l,3-1,4-glucanase activity was indicated by the formation of a halo around the colony. (a) S . cerevisiae /YGMPNA-PM; (b) Control strain / YEPlac181 Localization of β-1,3-1,4-glucanase 2 To determined whether β-1,3-1,4-glucanase was secreted into the culture medium or retained by the cells, the culture broth and cell pellets were separated by centrifugation and β-1,3-1,4-glucanase activity was measured in both fractions. Table 2 2 shows that the activity of β-1,3-1,4-glucanase in S . cerevisiae /YGMPNA-PM cell pellets was 45.1 U/ml, but was undetectable in the supernatant, indicating that the β-1,3-1,4-glucanase activity was associated with S . cerevisiae /YGMPNA-PM cells, not secreted into the culture. Values are averages of three independent experiments ND: not detected 2 Strain 3 Activity of the expressed enzyme a a Culture supernatant Cell pellet (U/ml) Relative activity (%) Strain (YGMPNA-PM) ND 45.1±3.2 100 Strain (YGMNA-PM) ND ND 0 Evaluation of the β-glucan-utilizing ability of S. cerevisiae /YGMPNA-PM 2 The expression of the β-1,3-1,4-glucanase gene in S . cerevisiae /YGMPNA-PM was induced by galactose in YPGL medium. Although the growth rate of yeast cells in YPGL medium was lower than that in YPD medium, this induction mode was used for lower repression of the galactose promoter ( GAL1 P ) than glucose-containing medium (Choi et al., 1994 1994 ). The culture course shows that β-1,3-1,4-glucanase activity in S . cerevisiae /YGMPNA-PM cells increased quickly after galactose addition and reached 45.1 U/ml after 32-h induction (Fig. 5 5 ). Subsequently, the enzyme activity decreased and then reached a plateau after 48 h induction. The reduction of β-1,3-1,4-glucanase activity was likely to have resulted from the loss of plasmid under non-selective pressure and the depletion of galactose. Fig. 5 5 shows that galactose was exhausted rapidly after 20 h. The metabolism of galactose by yeast was the expression-limiting factor in this work. Currently, we are constructing a GAL1 -disrupted industrial S . cerevisiae strain to improve further the β-1,3-1,4-glucanase activity, because GAL1 P is responsible for the first step of galactose catabolism (Štagoj and Komel, 2008 2008 ). The data points represent the average of three independent experiments Thermal stability of the β-1,3-1,4-glucanase in yeast cells 2 To investigate the thermostability of the enzyme in S . cerevisiae /YGMPNA-PM cells, the displayed enzymes were incubated at 50, 60 and 70 °C. Periodically, aliquots of cell suspension were taken and used for the residual activity measurement (Fig. 6 6 ). The residual activity of the free β-1,3-1,4-glucanase immediately decreased to 51.9% at 50 °C and to 20.1% at 60 °C, and was hardly detected at 70 °C after 2-h incubation. In contrast, the residual activity of β-1,3-1,4-glucanase in S . cerevisiae /YGMPNA-PM cells increased with incubation time and reached 129.2% at 60 °C and 109.2% at 70 °C after 1-h incubation, and then gradually decreased. After incubation for 3 h at 60 and 70 °C, the enzyme activity in S . cerevisiae /YGMPNA-PM cells remained at 64.6% and 35.8%, respectively, which indicated an improved thermostability. The data points represent the average of three independent experiments Discussion 1 β-1,3-1,4-glucanase can hydrolyze β-glucan and is considered to be helpful in beer production. To date, many studies have been carried out to improve its activity and performance by DNA recombinant techniques (Chen et al., 2001 2001 ; Teng et al., 2007 2007 ; Li et al., 2009 2009 ). However, little attention has been paid to the practicability and safety of the application of β-1,3-1,4-glucanase in the food industry. Table 3 3 shows a comparison of different systems used in studies of the expression of β-1,3-1,4-glucanase genes. In this study, the construction of a novel food-grade industrial arming yeast displaying β-1,3-1,4-glucanase was described and evaluated. 2 Expression system 2 Expression condition 2 Safety 2 Enzyme activity (U/ml) 2 Thermal stability 2 References Expression way 2 Selection marker E . coli BL21 Secretion Kanamycin No 24.1 Low Qiao et al., 2009 2009 L . lactis MB138 Display Erythromycin No 12.0 − Li et al., 2009 2009 Industrial S . cerevisiae Secretion G418 No 69.3 − Zhang Q. et al., 2008 2008 P . pastoris Secretion Kanamycin/His4 No 67.9 Low Teng et al., 2007 2007 Haploid S . cerevisiae Secretion URA Yes Weak − van Rensburg et al., 1997 1997 Haploid S . cerevisiae Secretion LEU Yes Weak Low Hinchliffe and Box, 1984 1984 Industrial S . cerevisiae Display α-galactosidase Yes 45.1 High This study Generally, auxotrophic markers such as URA3 , HIS3 , LEU2 , and TRP1 are the most commonly used selection markers in yeast transformation, and they are parts of food-grade markers. However, transformation by complementation of auxotrophic mutations cannot be employed for industrial polyploid yeasts. Estruch and Prieto ( 2003 2003 ) tried to construct a Trp − industrial yeast using a module containing the G418 resistance cassette, flanked by direct repeats from the MEL1 gene of S . cerevisiae . They obtained the desired yeast strains after four gene disruption rounds, but a remaining functional wild-type Trp copy was still present in the genome of the strain, which caused a high reversion frequency of the Trp − phenotype. Food-grade industrial recombinant yeast can also be constructed by other selective methods, such as self-cloning and co-transformation. In a previous study, our lab constructed a food-grade industrial yeast secreting β-1,3-1,4-glucanase by homologous recombination using “ loxP - KanMX - loxP ” as the selection marker, which permitted antibiotic marker removal between the two repeats “ loxp ” after transformation using plasmid pSH47 carrying the Cre-recombinase expression module (Zhang Q. et al., 2008 2008 ). However, the method was laborious because it involved several transformations and screening procedures to remove the selection marker. Co-transformation is also a technique that allows the construction of a food-grade yeast strain by using a vector carrying the gene of interest simultaneously with another plasmid carrying a selectable marker (Guerra et al., 2006 2006 ). A drawback related to co-transformation is low transformation efficiency. As the criteria for better markers are high transformation efficiency and reliability of true transformant selection (Akada, 2002 2002 ), we ruled out the co-transformation method. Recently, α-galactosidase was used as the food-grade selection marker in L . lactis and S . thermophilus . The characteristics of α-galactosidase make it a potential selective marker for yeast. It is convenient to screen and does not require the isolation of auxotrophic mutants of the industrial strain nor any antibiotic resistance genes. The S . cerevisiae /YGMPNA-PM using α-galactosidase as the selective marker in this work could be grown and selected on melibiose-containing medium, and the ability to express the β-1,3-1,4-glucanase gene of transformants was confirmed by the plate assay. The result proved the feasibility of using α-galactosidase as a selection marker in yeast. Furthermore, the expression of the MEL1 gene in yeast could be used to determine the number of pasteurization units of ale beer. The measurement of α-galactosidase activity has been proposed as a method of determining the number of pasteurization units (PU) of a lager beer (Enevoldsen, 1981 1981 ; 1985 1985 ). However, the α-galactosidase inactivation method is not generally applicable to ale beer at present, because the brewing ale strains ( S . cerevisiae ) do not produce α-galactosidase (Liljestrom-Suominen et al., 1988 1988 ; Gasent-Ramirez et al., 1995 1995 ). The MEL1 selection module constructed in this study, when introduced into industrial ale strains, not only could be used as the selection marker for transformation, but also could extend the method to beers other than lagers. The display of enzymes is one of the most attractive applications of cell-surface display in yeasts (Shibasaki et al., 2009 2009 ). The enzymes displayed on the cell surface of the brewer’s yeast offer an easy reproduction of biocatalysts and easy separation of products from catalysts (Kondo and Ueda, 2004 2004 ). Here, we report that β-1,3-1,4-glucanase was successfully immobilized on the cell wall of S . cerevisiae /YGMPNA-PM by an α-agglutinin anchor system and could hydrolyze β-glucan efficiently. Also, the thermal stability of the displayed β-1,3-1,4-glucanase on the cell surface of yeast cells was much improved compared with the free form. The thermal stability of β-1,3-1,4-glucanase plays an essential role in the degradation of barley β-glucan. During the malting and saccharification process, β-1,3-1,4-glucanase is heat-inactivated, leaving a high content of β-glucan in wort (Teng et al., 2006 2006 ). Immobilization can increase the stability of enzymes (Sakai et al., 1991 1991 ). Zhang W. et al. ( 2008 2008 ) reported that the thermostability of Rhizomucor miehei lipase displayed on the cell surface of S . cerevisiae using α-agglutinin as an anchor was improved. Some studies pointed out that enzymes displayed in P . pastoris had better thermal stability than those displayed in S . cerevisiae because P. pastoris was more appropriate for protein folding and the formation of disulfide bonds (Tanino et al., 2006 2006 ; Han et al., 2009 2009 ). However, P . pastoris is an unsuitable microorganism for use in the food industry. The mechanisms of the enhanced enzyme activity are still under investigation, but it has been postulated that the extent of glycosylation accounts for much of the stability difference between free and immobilized forms (Shusta et al., 1999 1999 ; Tanino et al., 2006 2006 ). Molecular rigidity of enzymes immobilized on the cell surface may be improved by attachment to a rigid support, which perhaps causes the enhanced thermostability in combination with the creation of a protected microenvironment (Mateo et al., 2007 2007 ). Thus, the thermal stability of β-1,3-1,4-glucanase in S . cerevisiae /YGMPNA-PM cells was superior to that of the free form and was more feasible for high temperature industrial reactions in the beer industry. In summary, we constructed a food-grade arming yeast strain that displayed β-1,3-1,4-glucanase with enhanced thermostability, thus meeting the requirements and market criteria for commercial use in the beer industry. Beer production with this yeast strain would represent a technical improvement and would also improve beer quality. Further studies on the fermentative properties and use of this recombinant arming yeast in beer brewing are under way. Acknowledgement 1 We thank Dr. Hu ZHENG (Columbia University, America) for his careful revision of this paper. References R Akada . Genetically modified industrial yeast ready for application . J Biosci Bioeng , 2002 . 94 ( 6 ): 536 - 544 . 16233347 DOI: 10.1263/jbb.94.536 http://doi.org/10.1263/jbb.94.536 . Genetically modified industrial yeast ready for application C Bamforth . β-glucan and β-glucanases in malting and brewing: practical aspects . Brew Dig , 1994 . 69 ( 5 ): 12 - 16 . . β-glucan and β-glucanases in malting and brewing: practical aspects S Bielecki , E Galas . Microbial β-glucanase different from cellulases . Crit Rev Biotechnol , 1991 . 10 ( 4 ): 275 - 305 . 1906376 DOI: 10.3109/07388559109038212 http://doi.org/10.3109/07388559109038212 . Microbial β-glucanase different from cellulases I Boucher , M Parrot , H Gaudreau , CP Champagne , C Vadeboncoeur , S Moineau . Novel food-grade plasmid vector based on melibiose fermentation for the genetic engineering of Lactococcus lactis . Appl Environ Microbiol , 2002 . 68 ( 12 ): 6152 - 6161 . 12450840 DOI: 10.1128/AEM.68.12.6152-6161.2002 http://doi.org/10.1128/AEM.68.12.6152-6161.2002 . Novel food-grade plasmid vector based on melibiose fermentation for the genetic engineering of Lactococcus lactis JL Chen , LC Tsai , TN Wen , JB Tang , HS Yuan , LF Shyur . Directed mutagenesis of specific active site residues on Fibrobacter succinogenes 1,3-1,4-beta-D-glucanase significantly affects catalysis and enzyme structural stability . J Biol Chem , 2001 . 276 ( 21 ): 17895 - 17901 . 11279139 DOI: 10.1074/jbc.M100843200 http://doi.org/10.1074/jbc.M100843200 . Directed mutagenesis of specific active site residues on Fibrobacter succinogenes 1,3-1,4-beta-D-glucanase significantly affects catalysis and enzyme structural stability ES Choi , JH Sohn , SK Rhee . Optimization of the expression system using galactose-inducible promoter for the production of anticoagulant hirudin in Saccharomyces cerevisiae . Appl Microbiol Biotechnol , 1994 . 42 ( 4 ): 587 - 594 . 7765734 DOI: 10.1007/BF00173925 http://doi.org/10.1007/BF00173925 . Optimization of the expression system using galactose-inducible promoter for the production of anticoagulant hirudin in Saccharomyces cerevisiae B Enevoldsen . Demonstration of melibiase in non-pasteurized lager beers and studies on the heat stability of the enzyme . Carlsberg Res Comm , 1981 . 46 ( 1-2 ): 37 - 42 . DOI: 10.1007/BF02906196 http://doi.org/10.1007/BF02906196 . Demonstration of melibiase in non-pasteurized lager beers and studies on the heat stability of the enzyme B Enevoldsen . Determining pasteurization units from residual melibiase activity in lager beer . J Am Soc Brew Chem (USA) , 1985 . 43 ( 4 ): 183 - 189 . . Determining pasteurization units from residual melibiase activity in lager beer F Estruch , JA Prieto . Construction of a Trp − comercial baker’s yeast strain by using food-safe-grade dominant drug resistance cassettes . FEMS Yeast Res , 2003 . 4 ( 3 ): 329 - 338 . 14654438 DOI: 10.1016/S1567-1356(03)00164-8 http://doi.org/10.1016/S1567-1356(03)00164-8 . Construction of a Trp− comercial baker’s yeast strain by using food-safe-grade dominant drug resistance cassettes SA Gai , KD Wittrup . Yeast surface display for protein engineering and characterization . Curr Opin Struct Biol , 2007 . 17 ( 4 ): 467 - 473 . 17870469 DOI: 10.1016/j.sbi.2007.08.012 http://doi.org/10.1016/j.sbi.2007.08.012 . Yeast surface display for protein engineering and characterization JM Gasent-Ramirez , AC Codon , T Benitez . Characterization of genetically transformed Saccharomyces cerevisiae baker’s yeasts able to metabolize melibiose . Appl Environ Microbiol , 1995 . 61 ( 6 ): 2113 - 2121 . 7793932 . Characterization of genetically transformed Saccharomyces cerevisiae baker’s yeasts able to metabolize melibiose RD Gietz , A Sugino . New yeast- Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites . Gene , 1988 . 74 ( 2 ): 527 - 534 . 3073106 DOI: 10.1016/0378-1119(88)90185-0 http://doi.org/10.1016/0378-1119(88)90185-0 . New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites OG Guerra , IGS Rubio , CGDS Filho , RA Bertoni , RCDS Govea , EJ Vicente . A novel system of genetic transformation allows multiple integrations of a desired gene in Saccharomyces cerevisiae chromosomes . J Microbiol Methods , 2006 . 67 ( 3 ): 437 - 445 . 16831478 DOI: 10.1016/j.mimet.2006.04.014 http://doi.org/10.1016/j.mimet.2006.04.014 . A novel system of genetic transformation allows multiple integrations of a desired gene in Saccharomyces cerevisiae chromosomes ZL Han , SY Han , SP Zheng , Y Lin . Enhancing thermostability of a Rhizomucor miehei lipase by engineering a disulfide bond and displaying on the yeast cell surface . Appl Microbiol Biotechnol , 2009 . 85 ( 1 ): 117 - 126 . 19533118 DOI: 10.1007/s00253-009-2067-8 http://doi.org/10.1007/s00253-009-2067-8 . Enhancing thermostability of a Rhizomucor miehei lipase by engineering a disulfide bond and displaying on the yeast cell surface GE Harman , CP Kubicek . Trichoderma and Gliocladium , 1998 . : Padstow, UK T.J. International Ltd. , 327 - 342 . . Trichoderma and Gliocladium E Hinchliffe , WG Box . Expression of the cloned endo-1,3-1,4-β-glucanase gene of Bacillus subtilis in Saccharomyces cerevisiae . Curr Genet , 1984 . 8 ( 6 ): 471 - 475 . DOI: 10.1007/BF00433914 http://doi.org/10.1007/BF00433914 . Expression of the cloned endo-1,3-1,4-β-glucanase gene of Bacillus subtilis in Saccharomyces cerevisiae DW Jeong , JH Lee , KH Kimc , HJ Lee . A food-grade expression/secretion vector for Lactococcus lactis that uses an alpha-galactosidase gene as a selection marker . Food Microbiol , 2006 . 23 ( 5 ): 468 - 475 . 16943039 DOI: 10.1016/j.fm.2005.06.003 http://doi.org/10.1016/j.fm.2005.06.003 . A food-grade expression/secretion vector for Lactococcus lactis that uses an alpha-galactosidase gene as a selection marker RMH John . Genetically-modified brewing yeasts for the 21st century . Progress to Date , 1995 . 11 ( 16 ): 1613 - 1627 . . Genetically-modified brewing yeasts for the 21st century A Kondo , M Ueda . Yeast cell-surface display-applications of molecular display . Appl Microbiol Biotechnol , 2004 . 64 ( 1 ): 28 - 40 . 14716465 DOI: 10.1007/s00253-003-1492-3 http://doi.org/10.1007/s00253-003-1492-3 . Yeast cell-surface display-applications of molecular display S Labrie , C Bart , C Vadeboncoeur , S Moineau . Use of an α-galactosidase gene as a food-grade selection marker for Streptococcus thermophilus . J Dairy Sci , 2005 . 88 2341 - 2347 . 15956297 . Use of an α-galactosidase gene as a food-grade selection marker for Streptococcus thermophilus AM Li , ZS Liu , QX Li , L Yu , DC Wang , XM Deng . Construction and characterization of bidirectional expression vectors in Saccharomyces cerevisiae . FEMS Yeast Res , 2008 . 8 ( 1 ): 6 - 9 . 18031531 DOI: 10.1111/j.1567-1364.2007.00335.x http://doi.org/10.1111/j.1567-1364.2007.00335.x . Construction and characterization of bidirectional expression vectors in Saccharomyces cerevisiae X Li , X Huang , X Shao , L Li . Functional cell surface display of endo-beta-1,3-1,4-glucanase in Lactococcus lactis using N -acetylmuraminidase as the anchoring motif . Chin J Biotechnol , 2009 . 25 ( 1 ): 89 . Functional cell surface display of endo-beta-1,3-1,4-glucanase in Lactococcus lactis using N-acetylmuraminidase as the anchoring motif PL Liljestrom-Suominen , V Joutsjoki , M Korhola . Construction of a stable alpha-galactosidase-producing baker’s yeast strain . Appl Environ Microbiol , 1988 . 54 ( 1 ): 245 - 249 . 16347529 . Construction of a stable alpha-galactosidase-producing baker’s yeast strain C Mateo , JM Palomo , G Fernandez-Lorente , JM Guisan , R Fernandez-Lafuente . Improvement of enzyme activity, stability and selectivity via immobilization techniques . Enzyme Microb Technol , 2007 . 40 ( 6 ): 1451 - 1463 . DOI: 10.1016/j.enzmictec.2007.01.018 http://doi.org/10.1016/j.enzmictec.2007.01.018 . Improvement of enzyme activity, stability and selectivity via immobilization techniques B McCleary . α-galactosidase from luciferine and guar seed . Methods Enzymol , 1988 . 160 627 - 632 . DOI: 10.1016/0076-6879(88)60178-9 http://doi.org/10.1016/0076-6879(88)60178-9 . α-galactosidase from luciferine and guar seed CA Miller III , MA Martinat , LE Hyman . Assessment of aryl hydrocarbon receptor complex interactions using pBEVY plasmids: expression vectors with bi-directional promoters for use in Saccharomyces cerevisiae . Nucl Acids Res , 1998 . 26 ( 15 ): 3577 - 3583 . 9671822 DOI: 10.1093/nar/26.15.3577 http://doi.org/10.1093/nar/26.15.3577 . Assessment of aryl hydrocarbon receptor complex interactions using pBEVY plasmids: expression vectors with bi-directional promoters for use in Saccharomyces cerevisiae JJ Muller , KK Thomsen , U Heinemann . Crystal structure of barley 1,3-1,4-beta-glucanase at 2.0-A resolution and comparison with Bacillus 1,3-1,4-beta-glucanase . J Biol Chem , 1998 . 273 ( 6 ): 3438 - 3446 . 9452466 DOI: 10.1074/jbc.273.6.3438 http://doi.org/10.1074/jbc.273.6.3438 . Crystal structure of barley 1,3-1,4-beta-glucanase at 2.0-A resolution and comparison with Bacillus 1,3-1,4-beta-glucanase T Murai , M Ueda , H Atomi , Y Shibasaki , N Kamasawa , M Osumi , T Kawaguchi , M Arai , A Tanaka . Genetic immobilization of cellulase on the cell surface of Saccharomyces cerevisiae . Appl Microbiol Biotechnol , 1997 . 48 ( 4 ): 499 - 503 . 9390459 DOI: 10.1007/s002530051086 http://doi.org/10.1007/s002530051086 . Genetic immobilization of cellulase on the cell surface of Saccharomyces cerevisiae L Navas , M Esteban , MA Delgado . KAR1-mediated transformation of brewing yeast . J Inst Brew , 1991 . 97 115 - 118 . . KAR1-mediated transformation of brewing yeast S Park , Y Xu , XF Stowell , F Gai , JG Saven , ET Boder . Limitations of yeast surface display in engineering proteins of high thermostability . Protein Eng Des Sel , 2006 . 19 ( 5 ): 211 - 217 . 16537642 DOI: 10.1093/protein/gzl003 http://doi.org/10.1093/protein/gzl003 . Limitations of yeast surface display in engineering proteins of high thermostability JT Pronk . Auxotrophic yeast strains in fundamental and applied research . Appl Environ Microbiol , 2002 . 68 ( 5 ): 2095 - 2100 . 11976076 DOI: 10.1128/AEM.68.5.2095-2100.2002 http://doi.org/10.1128/AEM.68.5.2095-2100.2002 . Auxotrophic yeast strains in fundamental and applied research J Qiao , B Dong , Y Li , B Zhang , Y Cao . Cloning of a β-1,3-1,4-glucanase gene from Bacillus subtilis MA139 and its functional expression in Escherichia coli . Appl Biochem Biotechnol , 2009 . 152 ( 2 ): 334 - 342 . 18365147 DOI: 10.1007/s12010-008-8193-4 http://doi.org/10.1007/s12010-008-8193-4 . Cloning of a β-1,3-1,4-glucanase gene from Bacillus subtilis MA139 and its functional expression in Escherichia coli H Ruohola , PL Liljestrom , T Torkkeli , H Kopu , P Lehtinen , N Kalkkinen , M Korhola . Expression and regulation of the yeast MEL1 gene . FEMS Microbiol Lett , 1986 . 34 ( 2 ): 179 - 185 . DOI: 10.1111/j.1574-6968.1986.tb01400.x http://doi.org/10.1111/j.1574-6968.1986.tb01400.x . Expression and regulation of the yeast MEL1 gene K Sakai , T Uchiyama , Y Matahira , F Nanjo . Immobilization of chitinolytic enzymes and continuous production of N -acetylglucosamine with the immobilized enzymes . J Ferment Bioeng , 1991 . 72 ( 3 ): 168 - 172 . DOI: 10.1016/0922-338X(91)90211-X http://doi.org/10.1016/0922-338X(91)90211-X . Immobilization of chitinolytic enzymes and continuous production of N-acetylglucosamine with the immobilized enzymes S Shibasaki , H Maeda , M Ueda . Molecular display technology using yeast-arming technology . Anal Sci , 2009 . 25 ( 1 ): 41 - 49 . 19139571 DOI: 10.2116/analsci.25.41 http://doi.org/10.2116/analsci.25.41 . Molecular display technology using yeast-arming technology EV Shusta , MC Kieke , E Parke , DM Kranz , KD Wittrup . Yeast polypeptide fusion surface display levels predict thermal stability and soluble secretion efficiency . J Mol Biol , 1999 . 292 ( 5 ): 949 - 956 . 10512694 DOI: 10.1006/jmbi.1999.3130 http://doi.org/10.1006/jmbi.1999.3130 . Yeast polypeptide fusion surface display levels predict thermal stability and soluble secretion efficiency M Štagoj , R Komel . The GAL induction response in yeasts with impaired galactokinase Gal1p activity . World J Microbiol Biotechnol , 2008 . 24 ( 10 ): 2159 - 2166 . DOI: 10.1007/s11274-008-9724-4 http://doi.org/10.1007/s11274-008-9724-4 . The GAL induction response in yeasts with impaired galactokinase Gal1p activity T Tanino , H Fukuda , A Kondo . Construction of a Pichia pastoris cell-surface display system using Flo1p anchor system . Biotechnol Progr , 2006 . 22 ( 4 ): 989 - 993 . DOI: 10.1021/bp060133+ http://doi.org/10.1021/bp060133+ . Construction of a Pichia pastoris cell-surface display system using Flo1p anchor system D Teng , JH Wang , Y Fan , YL Yang , ZG Tian , J Luo , GP Yang , F Zhang . Cloning of β-1,3-1,4-glucanase gene from Bacillus licheniformis EGW039 (CGMCC 0635) and its expression in Escherichia coli BL21 (DE3) . Appl Microbiol Biotechnol , 2006 . 72 ( 4 ): 705 - 712 . 16470364 DOI: 10.1007/s00253-006-0329-2 http://doi.org/10.1007/s00253-006-0329-2 . Cloning of β-1,3-1,4-glucanase gene from Bacillus licheniformis EGW039 (CGMCC 0635) and its expression in Escherichia coli BL21 (DE3) D Teng , Y Fan , YL Yang , ZG Tian , J Luo , JH Wang . Codon optimization of Bacillus licheniformis β-1,3-1,4-glucanase gene and its expression in Pichia pastoris . Appl Microbiol Biotechnol , 2007 . 74 ( 5 ): 1074 - 1083 . 17216453 DOI: 10.1007/s00253-006-0765-z http://doi.org/10.1007/s00253-006-0765-z . Codon optimization of Bacillus licheniformis β-1,3-1,4-glucanase gene and its expression in Pichia pastoris JR Thompson , E Register , J Curotto , M Kurtz , R Kelly . An improved protocol for the preparation of yeast cells for transformation by electroporation . Yeast , 1998 . 14 ( 6 ): 565 - 571 . 9605506 DOI: 10.1002/(SICI)1097-0061(19980430)14:6<565::AID-YEA251>3.0.CO;2-B http://doi.org/10.1002/(SICI)1097-0061(19980430)14:6<565::AID-YEA251>3.0.CO;2-B . An improved protocol for the preparation of yeast cells for transformation by electroporation LC Tsai , LF Shyur , YS Cheng , SH Lee . Crystal structure of truncated Fibrobacter succinogenes 1,3-1,4-beta-d-glucanase in complex with beta-1,3-1,4-cellotriose . J Mol Biol , 2005 . 354 ( 3 ): 642 - 651 . 16246371 DOI: 10.1016/j.jmb.2005.09.041 http://doi.org/10.1016/j.jmb.2005.09.041 . Crystal structure of truncated Fibrobacter succinogenes 1,3-1,4-beta-d-glucanase in complex with beta-1,3-1,4-cellotriose RS Tuan . Recombinant Gene Expression Protocols , 1997 . : Philadelphia, USA Humana Press , 131 - 148 . DOI: 10.1385/0896034801 http://doi.org/10.1385/0896034801 . Recombinant Gene Expression Protocols P van Rensburg , WH van Zyl , IS Pretorius . Over-expression of the Saccharomyces cerevisiae exo-beta-1,3-glucanase gene together with the Bacillus subtilis endo-beta-1,3-1,4-glucanase gene and the Butyrivibrio fibrisolvens endo-beta-1,4-glucanase gene in yeast . J Biotechnol , 1997 . 55 ( 1 ): 43 - 53 . 9226961 DOI: 10.1016/S0168-1656(97)00059-X http://doi.org/10.1016/S0168-1656(97)00059-X . Over-expression of the Saccharomyces cerevisiae exo-beta-1,3-glucanase gene together with the Bacillus subtilis endo-beta-1,3-1,4-glucanase gene and the Butyrivibrio fibrisolvens endo-beta-1,4-glucanase gene in yeast RB Vis , K Lorenz . beta-Glucans: importance in brewing and methods of analysis . LWT Food Sci Technol , 1997 . 30 ( 4 ): 331 - 336 . . beta-Glucans: importance in brewing and methods of analysis PJ Wood , JD Erfle , RM Teather . Use of complex formation between Congo red and polysaccharides in detection and assay of polysaccharide hydrolases . Methods Enzymol , 1988 . 160 59 - 74 . DOI: 10.1016/0076-6879(88)60107-8 http://doi.org/10.1016/0076-6879(88)60107-8 . Use of complex formation between Congo red and polysaccharides in detection and assay of polysaccharide hydrolases Q Zhang , QH Chen , ML Fu , JL Wang , HB Zhang , GQ He . Construction of recombinant industrial Saccharomyces cerevisiae strain with bglS gene insertion into PEP4 locus by homologous recombination . J Zhejiang Univ Sci B , 2008 . 9 ( 7 ): 527 - 535 . 18600782 DOI: 10.1631/jzus.B0820019 http://doi.org/10.1631/jzus.B0820019 . Construction of recombinant industrial Saccharomyces cerevisiae strain with bglS gene insertion into PEP4 locus by homologous recombination W Zhang , S Han , D Wei , Y Lin , X Wang . Functional display of Rhizomucor miehei lipase on surface of Saccharomyces cerevisiae with higher activity and its practical properties . J Chem Technol Biotechnol , 2008 . 83 ( 3 ): 329 - 335 . DOI: 10.1002/jctb.1814 http://doi.org/10.1002/jctb.1814 . Functional display of Rhizomucor miehei lipase on surface of Saccharomyces cerevisiae with higher activity and its practical properties 10.1631/jzus.B0900185 Project (No. 2006AA10Z316) supported by the Hi-Tech Research and Development Program (863) of China 2009-07-01 2009-12-07 2009-11-12 2022-01-05 Copyright © Zhejiang University and Springer-Verlag Berlin Heidelberg 2010 2010 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 01 11