Effect of lead on ERK activity and the protective function of bFGF in rat primary culture astroglia

Effect of lead on ERK activity and the protective function of bFGF in rat primary culture astroglia first-author corresp ‡Corresponding Author ‡Corresponding Author †E-mail:ydslg@163.com †E-mail:ydslg@163.com ydslg@163.com Department of Biochemistry and Molecule Biology, College of Basic Medical Sciences, China Medical University, Shenyang 110001, China Department of Biochemistry and Molecule Biology, College of Basic Medical Sciences, China Medical University, Shenyang 110001, China Objective: 2 To observe the effects of lead on levels of phosphorylated extracellular signal regulated kinase (p-ERK) in the cytoplasm of primary cultures of rat astroglial cells and the possible protective effect of basic fibroblast growth factor (bFGF) on lead-induced effects. Methods: 2 The primary astroglia cells from 1~6 d old Wistar rats were cultured. The cells pretreated with the MEK1 (mitogen-activated protein kinase kinase 1) inhibitor PD98059 and bFGF, respectively, were exposed to Pb acetate of different concentrations for different times. Western blotting and reverse transcription polymerase chain reaction (RT-PCR) methods were used to detect the protein and mRNA expressions of ERK. Results: 2 mRNA expression for ERK peaked 15 min after initiation of lead exposure ( P < 0.05) and protein expression of p-ERK peaked at 30 min ( P < 0.05). ERK mRNA levels and p-ERK protein levels returned to baseline after 60 and 120 min of lead exposure, respectively ( P > 0.05). The increase in p-ERK levels in lead-treated cells could be inhibited by PD098059. Activation of ERK in the cells by lead was prevented by pretreatment with bFGF. Total ERK protein levels did not change under the same experimental conditions ( P > 0.05). Conclusion: 2 Low-level lead exposure resulted in transient activation of ERK through the MEK pathway, which then returned to basal levels in the continued presence of lead. Exogenous bFGF protected ERK signaling components in astroglia from lead poisoning. Lead Astroglia Extracellular signal regulated kinase (ERK) Basic fibroblast growth factor (bFGF) INTRODUCTION 1 Neurotoxic effects from exposure to low levels of Pb in the environment are a problem of significant magnitude in the whole world, especially in children and infants (Qian et al., 2000 2000 ; Zhu et al., 2005 2005 ; Suresh et al., 2006 2006 ). Though numerous studies have shown that Pb could accumulate in the brain when its concentration in the blood is elevated (Bradbury and Deane, 1993 1993 ), the mechanisms of Pb deposition in brain are not yet fully known. The cell type most responsible for Pb accumulation and storage in the central nervous system (CNS) is the astroglia (Sierra and Tiffany-Castiglioni, 1991 1991 ). In brain, astroglia could accumulate 24 times more lead than mature neural cells (Lindahl et al., 1999 1999 ) and in cell culture, astroglia has the capacity to concentrate Pb up to four times of magnitude higher than extracellular levels (Tiffany-Castiglioni, 1993 1993 ). ERK1/2 (extracellular signal regulated kinase 1/2) is an important element on the forming process of long-term potentiation (LTP) (Adams and Sweatt, 2002 2002 ). Pb could affect LTP by disturbing the expression of ERK and other signal molecules (Kanterewicz et al., 2000 2000 ; Lin et al., 2003 2003 ). Basic fibroblast growth factor (bFGF) is one of neurotrophic factors which could protect the neural cells from the damage of poison (Exkenstien, 1994 1994 ; Neben et al., 2001 2001 ). In order to investigate the possible protective effect of bFGF on the primarily cultured astroglia, we observed the mRNA and protein expression of ERK in the astroglia treated with bFGF and Pb acetate. MATERIALS AND METHODS 1 Materials 2 Healthy Wistar rats (1~6 d, provided by Animal Experimental Center, China Medical University, Shenyang, China), glial fibrillary acidic protein (GFAP) antibody and streptavi biotin-peroxidase complex (SABC) kit (Boster Biotechnology Co. Ltd., China), total ERK (t-ERK) and phosphorylated ERK (p-ERK) antibodies (Promega Biotechnology Co. Ltd., USA), bFGF (Beijing SL Pharmaceutical Co. Ltd., Beijing, China). Methods 2 1. Cell culture and identification 3 The hippocampus and cortex of Wistar rats were taken out and digested in Ca 2+ - and Mg 2+ -free Hanks’ balanced saline solution containing 0.125% trypsin. Cells were dissociated and plated into poly-L-lysine solution-coated plastic culture dishes and routinely cultured at 37 °C under 5% CO 2 with a mixture (1:1, v/v) of Dulbeccco’s Modified Eagle’s Medium/Nutrient Mixture F-12 (DMEM/F-12) supplemented with 10% fetal bovine serum (FBS). Thirty to forty-five minutes later, the unattached cells (i.e. astroglia cells) were transferred to another plastic dish with the same medium. When they grew to 80%~90% confluence, cells were incubated in 3 g/L H 2 O 2 for 30 min, and then blocked with goat serum for 10 min. Then, cells were incubated with GFAP antibody, goat anti-rabbit IgG, and SABC reagent for 2 h, 20 min, and 20 min at 37 °C, respectively. Next, the cells were stained with diamino benzidine (DAB) for 20 min. PBS (0.01 mol/L) was used to fully rinse the cells for 5 min×3 times between steps. Hematoxylin was used to stain nuclei. Finally, the cells were routinely dehydrated, cleared and mounted on glass slides. The control sections were incubated with PBS to rule out false positive results. 2. Cell experimental treatments 3 Pb acetate was added to the same FBS-supplemented DMEM/F-12 medium at final concentrations of 0.2, 1.0 and 10 μmol/L. Cells were exposed to Pb acetate of different concentrations for 30 min or 1.0 μmol/L Pb acetate for 0, 5, 15, 30, 60 or 120 min. For inhibitor and bFGF groups, cells were pretreated with 100 μmol/L MAPK (mitogen-activated protein kinase) kinase 1 (MEK1) inhibitor PD98059 or 40 ng/L bFGF for 1 h respectively, and then exposed to 1.0 μmol/L Pb acetate for 0, 5, 15, 30, 60 or 120 min. 3. RT-PCR analysis 3 Total RNA was extracted with Trizol extraction liquid and reverse transcribed to synthesize cDNA (42 °C for 30 min, 99 °C for 5 min, 5 °C for 5 min). An ERK2 primer (sense: TGTTGTCCTCCCTCCTC; antisense: CGCCTTCTCCGATGTAC; product sizes: 343 bp) was incubated with the internal control β-actin primer (sense: AGACCTCTATGCCAACACAGTGCTG; antisense: TCATCGTACTCCTGCTTGCTGCTGA; product sizes: 218 bp) under the following conditions: denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 60 s. After 30 cycles, desired DNA products were obtained and identified by 1.5% agarose gel electrophoresis with a PCR marker as a molecular weight comparison. The densities of the ERK2 band and the internal control β-actin band were determined by DNA scanner. The value of the density ratio (ERK2/β-actin) represented the level of each subunit mRNA. 4. Western blot analysis 3 The harvested cells were ruptured with a Sonifer Cell Disruptor and centrifuged. The supernate (i.e. total protein) was separated on a 12% acrylamide SDS-PAGE gel and electroblotted to a nitrocellulose membrane. The membrane was blocked with 5% (w/v) free-fat milk and then incubated with a monoclonal antibody to p-ERK (rat origin, 1:400) and a polyclonal antibody to t-ERK (rabbit origin, 1:400) overnight at 4 °C, respectively, followed by incubation with horseradish peroxidase-conjugated secondary antibodies (1:5000) for 1 h at room temperature. Membranes were exposed to the electrochemiluminescence (ECL) reagents and then to the X-ray film. Chemiluminescent reagent 5500 and Scion image software were used to detect results for expressions of protein. The value of density ratio (p-ERK/β-actin) represented the level of each subunit protein. Data analysis 2 Measurements were expressed as mean± SD and statistical analysis was performed by one-way ANOVA test with SPSS 13.0 software. P < 0.05 was regarded as a significant difference. Each experiment was repeated three times, and the value of three samples averaged was compared among groups. RESULTS 1 Qualitative analysis of the experimental astroglia 2 By immunohistochemical staining and observing under the microscope, more than 95% cells were stained positively for GFAP as indicated by the brown DAB reaction product in the cytoplasm, indicating that they were astroglia. The nuclei were stained blue (Fig. 1 1 ). Cells were incubated with GFAP antibody (PBS was used as substitute of GFAP in negative control) and observed under the microscope. Almost all cells were stained with brown in the cytoplasm and blue in the karyon (cells were not stained with brown in the cytoplasm in negative control) mRNA expression of ERK2 2 The result of the agrose gel electrophoresis is shown in Figs. 2 2 and 3 3 . 1: Blank control; 2~6: 1.0 μmol/L Pb acetate treated for 5, 15, 30, 60 or 120 min. Compared with that of the control, the mRNA expression of ERK2 began to increase at beginning 5 min after the initiation of lead exposure, peaking at 15 min and returning to the basal level thereafter. The experiment was conducted 3 times and a representative gel is shown 1~6: 1.0 μmol/L Pb acetate treated for 0, 5, 15, 30, 60 or 120 min after bFGF incubation for 1 h. Compared with the control, the level of ERK2 mRNA expression had no significant change. The experiment was conducted 3 times and a representative gel is shown Compared with that of the control, the level of ERK2 mRNA expression began to increase after 5 min exposure to Pb and peaked at 15 min ( P < 0.05) (Table 1 1 ), and then gradually returned to the basal level. No statistically significant differences were found between the control and the groups pretreated with bFGF prior to Pb treatment ( P > 0.05) (Table 1 1 ). Cells were treated with 1.0 μmol/L Pb acetate for 0, 5, 15, 30, 60 or 120 min after bFGF incubation for 1 h Compared with the control in the respective groups, P < 0.05 2 Time (min) 2 ERK2/β-actin Pb bFGF+Pb ▲ ▲ 0 (control) 0.915±0.006 0.963±0.004 5 1.052±0.004 * * 0.964±0.004 15 1.108±0.006 * * 0.964±0.004 30 1.061±0.003 * * 0.964±0.003 60 0.940±0.007 0.963±0.007 120 0.926±0.007 0.964±0.003 Protein expression of t-ERK and p-ERK 2 The results of the SDS-PAGE gel electrophoresis are shown in Figs. 4 4 ~ 7 7 . 0: Blank control; 1~3: Concentrations of Pb acetate were 0.2, 1.0 and 10 μmol/L in order. Compared with that of the control, the results showed an inverted U shaped curve. The experiment was conducted 3 times and a representative gel is shown 0: Blank control; 1~5: 1.0 μmol/L Pb acetate treated for 5, 15, 30, 60 or 120 min respectively. Compared with that of the control, the level of p-ERK protein expression began to increase from the 5 min point to the peak at 30 min, and then came back to the normal level. The experiment was conducted 3 times and a representative gel is shown 0~5: 1.0 μmol/L Pb acetate treated for 0, 5, 15, 30, 60 or 120 min after 100 μmol/L PD98059 incubation for 1 h. PD98059 prevented the lead-induced increase of p-ERK protein. The experiment was conducted 3 times and a representative gel is shown 0~5: 1.0 μmol/L Pb acetate treated for 0, 5, 15, 30, 60 or 120 min after 40 ng/L bFGF incubation for 1 h. bFGF could restrain the increase of lead-induced p-ERK protein. The experiment was conducted 3 times and a representative gel is shown After incubation with 0.2, 1.0 and 10 μmol/L Pb acetate for 30 min, the expression of p-ERK was higher than that of the control group ( P < 0.05) (Table 2 2 ). After 5, 15, 30, 60 and 120 min incubation in 1.0 μmol/L Pb acetate, the expression of p-ERK was gradually increased, peaking at 30 min ( P < 0.05) (Table 3 3 ). In the PD98059 pretreatment group, ERK activity was unchanged ( P > 0.05) (Table 3 3 ). In the bFGF pretreatment group, bFGF and Pb acetate increased the expression of p-ERK protein respectively, but bFGF prevented increase of lead-induced p-ERK protein. Compared with that of the blank control, the expression of p-ERK showed no change ( P > 0.05) (Table 3 3 ). The levels of t-ERK showed no significant changes under different experimental conditions ( P > 0.05). Compared with the control, P < 0.05 Pb acetate (μmol/L) p-ERK/β-actin 0 (control) 0.777±0.003 0.2 0.934±0.004 * * 1.0 1.324±0.003 * * 10 0.903±0.004 * * Cells were treated with 1.0 μmol/L Pb acetate for 0, 5, 15, 30, 60 or 120 min after PD98059 or bFGF incubation for 1 h Compared with the control in the respective groups, P < 0.05 2 Time (min) 3 p-ERK/β-actin Pb PD98059+Pb ▲ ▲ bFGF+Pb ▲ ▲ 0 (control) 0.776±0.003 0.717±0.004 0.779±0.001 5 0.780±0.002 0.765±0.005 * * 0.775±0.001 15 1.067±0.002 * * 0.765±0.004 * * 0.776±0.001 30 1.405±0.004 * * 0.766±0.003 * * 0.778±0.002 60 1.073±0.002 * * 0.763±0.004 * * 0.777±0.002 120 0.781±0.003 0.768±0.002 * * 0.776±0.002 DISCUSSIONS AND CONCLUSION 1 Lead is a widespread environmental toxicant whose developmental neurotoxicity remains a major medical issue. There is growing evidence that lead can directly alter cellular physiology at multiple levels which include interference with ion channels and activation of second messengers, in particular calcium-dependent messengers, which ultimately affect transcription factors and gene expression (Mir et al., 2000 2000 ; Cui et al., 2005 2005 ). In addition, numerous studies have shown that astroglia are the main site of Pb deposition in the CNS (Sierra and Tiffany-Castiglioni, 1991 1991 ; Tiffany-Castiglioni, 1993 1993 ). This report addresses the change of selected signal molecules in astroglia exposed to lead in primary culture. ERK1/2 is an important element on the forming process of LTP which is regarded as the accepted mechanism for learning and memory function (Kanterewicz et al., 2000 2000 ; Adams and Sweatt, 2002 2002 ). Activation of mitogen-activated protein kinases (MAPKs) is regulated through a three-kinase complex composed of a MAPK, a MAPK kinase (MEK) and a MEK kinase (MEKK) (Kolch, 2000 2000 ; Nebreda and Porras, 2000 2000 ; Chang and Karin, 2001 2001 ). These MAPK complexes are connected to the cell surface receptor and activated through interaction with a family of small GTPases and MEKK kinases. ERK1/2 exemplifies one class of MAPK that undergoes activation by a range of stimuli including growth factors, cytokines, cell adhesion, tumor-promoting phorbol esters and oncogenes (Whitmarsh and Davis, 2000 2000 ). It is well known that ERK1/2 activation is necessary for cell growth because it phosphorylates and activates numerous substrates involved in nucleotide synthesis, gene transcription, protein synthesis and cell cycle progression (Dhandapani et al., 2007 2007 ). bFGF, a pleiotropic cytokine, is important for embryogenesis, angiogenesis, wound healing, and mesodermal development. Due to its stimulatory capacity on the formation of new blood vessels, bFGF is suggested to play a major role in growth and dissemination of tumors (Basilico and Moscatelli, 1992 1992 ; Ensoli et al., 1994 1994 ; Spence et al., 2007 2007 ). Many studies have suggested that bFGF is one of neurotrophic factors which could protect neural cells from toxicant-induced damage. The abnormal expression of p-ERK may affect LTP and then disturb the functions of learning and memory. PD98059 is the special inhibitor of MEK1, which is upstream kinase of ERK. Our results demonstrated PD98059 could prevent the activation of p-ERK induced by Pb which indicated that low-level lead exposure of primary rat astroglial cultures resulted in transient stimulation of ERK mRNA levels and p-ERK protein levels through the MEK pathway. This stimulation was followed by recovery to basal levels, even in the continued presence of lead. When cells were pretreated with 40 ng/L bFGF for 1 h and then exposed to 1.0 μmol/L Pb acetate for up to 2 h, the lead-induced increase of p-ERK levels was prevented. Thus bFGF protected astroglia culture from this effect of Pb on intracellular signaling. The maintenance of normal activity of ERK is essential and necessary for LTP and its function in learning and memory. Our results show that exogenous bFGF can protect ERK activity against the influence of lead. Therefore, bFGF may be a neurotrophic and protective factor modulated by MEK1/ERK signal pathway. References JP Adams , JD Sweatt . Molecular psychology: roles for the ERK MAP kinase cascade in memory . Annu Rev Pharmacol Toxicol , 2002 . 42 ( 1 ): 135 - 163 . 11807168 DOI: 10.1146/annurev.pharmtox.42.082701.145401 http://doi.org/10.1146/annurev.pharmtox.42.082701.145401 . Molecular psychology: roles for the ERK MAP kinase cascade in memory C Basilico , D Moscatelli . The FGF family of growth factors and oncogenes . Adv Cancer Res , 1992 . 59 115 - 165 . 1381547 . The FGF family of growth factors and oncogenes MW Bradbury , R Deane . Permeability of the blood-brain barrier to lead . Neurotoxicology , 1993 . 14 ( 2-3 ): 131 - 136 . 8247388 . Permeability of the blood-brain barrier to lead L Chang , M Karin . Mammalian MAP kinase signaling cascades . Nature , 2001 . 410 ( 6824 ): 37 - 40 . 11242034 DOI: 10.1038/35065000 http://doi.org/10.1038/35065000 . Mammalian MAP kinase signaling cascades Y Cui , YG Zhu , R Zhai , Y Huang , Y Qiu , J Liang . Exposure to metal mixtures and human health impacts in a contaminated area in Nanning, China . Environ Int , 2005 . 31 ( 6 ): 784 - 790 . 15979144 DOI: 10.1016/j.envint.2005.05.025 http://doi.org/10.1016/j.envint.2005.05.025 . Exposure to metal mixtures and human health impacts in a contaminated area in Nanning, China KM Dhandapani , MM Khan , FM Wade , C Wakade , VB Mahesh , DW Brann . Induction of transforming growth factor-beta1 by basic fibroblast growth factor in rat C6 glioma cells and astrocytes is mediated by MEK/ERK signaling and AP-1 activation . J Neurosci Res , 2007 . 85 ( 5 ): 1033 - 1045 . 17335076 DOI: 10.1002/jnr.21182 http://doi.org/10.1002/jnr.21182 . Induction of transforming growth factor-beta1 by basic fibroblast growth factor in rat C6 glioma cells and astrocytes is mediated by MEK/ERK signaling and AP-1 activation B Ensoli , P Markham , V Kao , G Barillari , V Fiorelli , R Gendelman , M Raffeld , G Zon , RC Gallo . Block of AIDS-Kaposi’s sarcoma (KS) cell growth, angiogenesis, and lesion formation in nude mice by antisense oligonudeotide targeting basic fibroblast growth factor. A novel strategy for the therapy of KS . J Clin Invest , 1994 . 94 ( 5 ): 1736 - 1746 . 7525646 . Block of AIDS-Kaposi’s sarcoma (KS) cell growth, angiogenesis, and lesion formation in nude mice by antisense oligonudeotide targeting basic fibroblast growth factor. A novel strategy for the therapy of KS FP Exkenstien . Fibroblast growth factors in the nervous system . J Neurobio , 1994 . 25 ( 11 ): 1467 - 1480 . DOI: 10.1002/neu.480251112 http://doi.org/10.1002/neu.480251112 . Fibroblast growth factors in the nervous system BI Kanterewicz , NN Urban , DB McMahon , ED Norman , LJ Giffen , MF Favata , PA Scherle , JM Trzskos , G Barrionuevo , E Klann . The extracellular signal regulated kinase cascade is required for NMDA receptor in dependent LTP in area CA1 but not area CA3 of the hippocampus . J Neurosci , 2000 . 20 ( 9 ): 3057 - 3066 . 10777769 . The extracellular signal regulated kinase cascade is required for NMDA receptor in dependent LTP in area CA1 but not area CA3 of the hippocampus W Kolch . Meaningful relationships: the regulation of the Ras/Raf/MEK/ERK pathway by protein interactions . Biochem J , 2000 . 351 ( 2 ): 289 - 305 . 11023813 DOI: 10.1042/0264-6021:3510289 http://doi.org/10.1042/0264-6021:3510289 . Meaningful relationships: the regulation of the Ras/Raf/MEK/ERK pathway by protein interactions YW Lin , SM Chuang , JL Yang . Persistent activation of ERK1/2 by lead acetate increases nucleotide excision repair synthesis and confers anti-cytotoxicity and anti-mutagenicity . Carcinogenesis , 2003 . 24 ( 1 ): 53 - 61 . 12538349 DOI: 10.1093/carcin/24.1.53 http://doi.org/10.1093/carcin/24.1.53 . Persistent activation of ERK1/2 by lead acetate increases nucleotide excision repair synthesis and confers anti-cytotoxicity and anti-mutagenicity LS Lindahl , L Bird , ME Legare , G Mikeska , GR Bratton , E Tiffany-Castiglioni . Differential ability of astroglia and neuronal cells to accumulate lead: dependence on cell type and on degree of differentiation . Toxicol Sci , 1999 . 50 ( 2 ): 236 - 243 . 10478860 DOI: 10.1093/toxsci/50.2.236 http://doi.org/10.1093/toxsci/50.2.236 . Differential ability of astroglia and neuronal cells to accumulate lead: dependence on cell type and on degree of differentiation AH Mir , MLB Christopher , P Jonathan , L John . Induction of vascular endothelial growth factor in human astrocytes by lead . J Biol Chem , 2000 . 275 ( 36 ): 27874 - 27882 . 10882716 . Induction of vascular endothelial growth factor in human astrocytes by lead K Neben , T Moehler , G Egerer , A Kraemer , J Hillengass , A Benner , AD Ho , H Goldschmidt . High plasma basic fibroblast growth factor concentration is associated with response to thalidomide in progressive multiple myeloma . Clin Cancer Res , 2001 . 7 ( 9 ): 2675 - 2681 . 11555579 . High plasma basic fibroblast growth factor concentration is associated with response to thalidomide in progressive multiple myeloma AR Nebreda , A Porras . p38 MAP kinases: beyond the stressresponse . Trends Biochem Sci , 2000 . 25 ( 6 ): 257 - 260 . 10838561 DOI: 10.1016/S0968-0004(00)01595-4 http://doi.org/10.1016/S0968-0004(00)01595-4 . p38 MAP kinases: beyond the stressresponse Y Qian , ED Harris , Y Zheng , E Tiffany-Castiglioni . Lead targets GRP78, a molecular chaperone, in C6 rat glioma cells . Toxicol Appl Pharmacol , 2000 . 163 ( 3 ): 260 - 266 . 10702365 DOI: 10.1006/taap.1999.8878 http://doi.org/10.1006/taap.1999.8878 . Lead targets GRP78, a molecular chaperone, in C6 rat glioma cells EM Sierra , E Tiffany-Castiglioni . Reduction of glutamine synthetase activity in astroglia exposed in culture to low levels of inorganic lead . Toxicology , 1991 . 65 ( 3 ): 295 - 304 . 1671539 DOI: 10.1016/0300-483X(91)90088-I http://doi.org/10.1016/0300-483X(91)90088-I . Reduction of glutamine synthetase activity in astroglia exposed in culture to low levels of inorganic lead JR Spence , M Madhavan , JC Aycinena , K Del Rio-Tsonis . Retina regeneration in the chick embryo is not induced by spontaneous Mitf downregulation but requires FGF/FGFR/MEK/Erk dependent upregulation of Pax6 . Mol Vis , 2007 . 24 ( 13 ): 57 - 65 . . Retina regeneration in the chick embryo is not induced by spontaneous Mitf downregulation but requires FGF/FGFR/MEK/Erk dependent upregulation of Pax6 C Suresh , AO Dennis , J Heinz , MC Vemuri , CS Chetty . Melatonin protection against lead-induced changes in human neruoblastoma cell cultures . Int J Toxicol , 2006 . 25 ( 6 ): 459 - 464 . 17132604 DOI: 10.1080/10915810600959576 http://doi.org/10.1080/10915810600959576 . Melatonin protection against lead-induced changes in human neruoblastoma cell cultures E Tiffany-Castiglioni . Cell culture models for lead toxicity in neuronal and glial cells . Neurotoxicology , 1993 . 14 ( 4 ): 513 - 536 . 8164894 . Cell culture models for lead toxicity in neuronal and glial cells AJ Whitmarsh , RJ Davis . Regulation of transcription factor function by phosphorylation . Cell Mol Life Sci , 2000 . 57 ( 8-9 ): 1172 - 1183 . 11028910 DOI: 10.1007/PL00000757 http://doi.org/10.1007/PL00000757 . Regulation of transcription factor function by phosphorylation ZW Zhu , RL Yang , GJ Dong , ZY Zhao . Study on the neurotoxic effects of low-level lead exposure in rats . J Zhejiang Univ Sci B , 2005 . 6 ( 7 ): 686 - 692 . 15973774 DOI: 10.1631/jzus.2005.B0686 http://doi.org/10.1631/jzus.2005.B0686 . Study on the neurotoxic effects of low-level lead exposure in rats 10.1631/jzus.2007.B0422 Project (No. 39970651) supported by the National Natural Science Foundation of China 2006-12-29 2007-03-16 2022-01-05 Copyright © 2007, Journal of Zhejiang University Science 2007 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 06 08