Genome-wide analysis of OCT4 binding sites in glioblastoma cancer cells#

Genome-wide analysis of OCT4 binding sites in glioblastoma cancer cells # # 1 2 first-author 1 2 2 2 2 2 2 2 1 corresp ‡Corresponding Authors ‡Corresponding Authors †E-mail:zhengshu@zju.edu.cnbiaoylin@zju.edu.cn †E-mail:zhengshu@zju.edu.cnbiaoylin@zju.edu.cn zhengshu@zju.edu.cn 2 corresp ‡Corresponding Authors ‡Corresponding Authors †E-mail:zhengshu@zju.edu.cnbiaoylin@zju.edu.cn †E-mail:zhengshu@zju.edu.cnbiaoylin@zju.edu.cn zhengshu@zju.edu.cn Key Laboratory of Cancer Prevention and Intervention of Ministry of Education, Key Laboratory of Molecular Biology in Medical Sciences of Zhejiang Province, Cancer Institute, the Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009, China Key Laboratory of Cancer Prevention and Intervention of Ministry of Education, Key Laboratory of Molecular Biology in Medical Sciences of Zhejiang Province, Cancer Institute, the Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009, China Systems Biology Division, Zhejiang-California International Nanosystems Institute (ZCNI), Zhejiang University, Hangzhou 310029, China Systems Biology Division, Zhejiang-California International Nanosystems Institute (ZCNI), Zhejiang University, Hangzhou 310029, China OCT4, a member of the POU family of gene products, is an octamer motif-binding transcription factor. As it is known to play a crucial role in cancer processes including proliferation, invasion, and chemoradioresistance, it is important to identify the direct targets of OCT4 in living cancer cells. Here, chromatin immunoprecipitation-sequencing (ChIP-seq) was used to identify OCT4 binding sites in glioblastoma cancer cells. The results showed that 5438 OCT4 binding sites were localized in the glioblastoma cancer genome and that these sites contained a consensus sequence TTTkswTw (k=T or G, s=C or G, w=A or T), which occurred 3931 times in 2312 OCT4 binding regions. Furthermore, binding motifs of some other transcription factors were identified in OCT4 binding regions. Our results provide a valuable dataset for understanding gene regulation mechanisms underlying the function of OCT4 in glioblastoma cancer. OCT4 Chromatin immunoprecipitation-sequencing (ChIP-seq) DNA binding region Glioblastoma Introduction 1 OCT4, a member of the POU family of gene products (Verrijzer et al., 1992 1992 ; Dekker et al., 1993 1993 ; Herr and Cleary, 1995 1995 ), is an octamer motif-binding transcription factor (TF), which is highly expressed in stem cells (Schoorlemmer et al., 1995 1995 ; Pesce et al., 1998 1998 ). OCT4 has been considered as a key molecule which could induce somatic cell pluripotency (Takahashi and Yamanaka, 2006 2006 ; Takahashi et al., 2007 2007 ). OCT4 is also essential for maintaining undifferentiated and pluripotent populations of cells (Yu et al., 2007 2007 ). Kim et al. ( 2009a 2009a ; 2009b 2009b ) reported that OCT4 can directly reprogram adult mouse and human neural stem cells to induced pluripotent stem (iPS) cells. These studied showed that OCT4 plays an important role in conferring the stemness of cells. In general, cancer cells are similar to early embryonic cells with the properties of immortality, undifferentiation, and invasion (Monk and Holding, 2001 2001 ). So, it is vital to study genes associated with embryogenesis and tumorigenesis. In recent years, there have been some reports on the deregulated expression of OCT4 in several cancers, such as human embryonal carcinomas (Kraft et al., 1996 1996 ), testicular germ cell tumors and seminomas (Cheng et al., 2007 2007 ), lung cancer (Chen et al., 2008 2008 ), and bladder carcinomas (Atlasi et al., 2007 2007 ). It is possible that aberrant expression of OCT4 may contribute to the progression of these cancers. Atlasi et al. ( 2007 2007 ) found that OCT4 is overexpressed in bladder cancer tissues compared with normal bladder tissues and can enhance bladder cancer cell migration and invasion. Schreiber et al. ( 1994 1994 ) showed that the expression of OCT4 was significantly higher in high-grade primary gliomas than in low-grade gliomas at the mRNA and protein levels (Schreiber et al., 1994 1994 ). Chen et al. ( 2008 2008 ) demonstrated that the expression of OCT4 is crucial in maintaining the self-renewing, cancer stem-like, and chemoradioresistance properties of CD133 + lung cancer cells. So far, system-wide investigation of the function of OCT4 has been focused only on embryonic cells. To understand the function of OCT4 in a genome-wide manner in cancer, we have used chromatin immunoprecipitation-sequencing (ChIP-seq) to determine the genome binding sites of OCT4 in living glioblastoma cells. We report here the genome-wide targets of OCT4 in glioblastoma cells identified by ChIP-seq, which provide us with a comprehensive dataset for improving our understanding of the role of OCT4 in tumor development. Materials and methods 1 Cell culture 2 U251 cells were obtained from the American Type Culture Collection (Manassas, VA) and maintained in Dulbecco’s modified Eagle medium (DMEM) with 10% fetal bovine serum (FBS). Immunoblot analysis 2 Cells were lysed in RIPA cell lysis buffer (25 mmol/L Tris-HCl (pH 7.6), 150 mmol/L NaCl, 0.01 g/ml NP-40, 0.01 g/ml sodium deoxycholate, 1 g/L sodium dodecyl sulfate (SDS)) containing protease inhibitor cocktail kit (Pierce, Rockford, IL, USA). A total of 20 µg of protein was loaded for Western blot analysis. The OCT4 (ab18976) antibody was purchased from Abcam (Cambridge, MA, USA). ChIP-seq procedure 2 The aforementioned anti-OCT4 antibody and normal IgG (SC-2027; Santa Cruz, CA, USA) were used for immunoprecipitation. Cells (1×10 7 U251) were fixed with 1% fresh formaldehyde and lysed in lysis buffer according to the protocol of Fang et al. ( 2010 2010 ). The nuclei were resuspended and sonicated on ice to chromatin of 200–500 bp DNA. A total of 50 µl of Dynal protein G beads, 5 µg of antibody, and the sonicated chromatin were incubated at 4 °C overnight. The precipitated immunocomplex was treated with proteinase K at 65 °C for 2 h and DNA was purified with QIAquick polymerase chain reaction (PCR) purification kit (Qiagen, USA). ChIP DNA was amplified, ligated with adaptor, and repaired at the DNA end. The 150 bp DNA fragments were isolated from agar gel and sequenced with a Solexa Illumina 2G genetic analyzer. ChIP-seq analysis 2 Solexa pipeline analysis was performed as described by Lin et al. ( 2009 2009 ) and Fang et al. ( 2010 2010 ). The SOAP program was used to map the 36 nucleotide sequence tags to the human genome with two mismatches allowed (Wang et al., 2009 2009 ; Fang et al., 2011 2011 ). We used the MACS program to identify the enriched peaks of the OCT4 binding sites with an IgG ChIP group dataset as control. The program parameters were set as follows: P -value cutoff of 1.00×10 −5 , model fold of 32, tag size of 36 bp of 5′ sequences, and effective size of 2.70×10 9 for the human genome. We annotated the datasets with the HG19 database using the CisGenome program (Ji et al., 2008 2008 ). Validation of ChIP-seq targets by real-time PCR 2 A list of binding peaks was selected and quantitative real-time PCR was performed to validate the OCT4 binding region dataset. The primers used are listed in Table 1 1 . Gene Forward primer Reverse primer   SOX4 CTGCTCTGTCCAGAGGCTTT AGTGTCGCGAACTCAAATCG   JUNB TCTCTCAAGCTCGCCTCTTC ACGTGGTTCATCTTGTGCAG   KLF6 CACAGGCATTGACAGGTACG ACTTGATTTGCTGGGTTTGG   MAP3K11 GTCCCAGAAGGGGTCTGAGT ATCCTCACAGGAGGCACTGT   FBXO17 TCCCAACACCAGAGATTTCC CTTCTCCTGCAAGGATCTCG   FOXA2 AGGTGCTTGAAGAAGCAGGA GAGACGCAAGGGAGAAGAAA   PIP5K2C GGAGACTATGGCGTCCTCCT TTCTCACCGAGTGGGCTAC   PARK7 GTTGCACTCAACCTCAAGCA AGAGGGGAGTGGTAGGATGC Analysis of distance to transcription start site 2 We used annotations of the UCSC human genome HG19 database to calculate the distance from transcription start sites (TSSs) to the binding sites. We also considered the strand’s direction when we calculated the distance: for the positive strand, the distance was from the TSS start position to the end position of the OCT4 binding region; for the negative strand, the distance was to the OCT4 binding region start position. Motif scanning and identification 2 For the identification of the novel motifs, we extended the OCT4 binding sites observed by ChIP-seq to 100 bp 3′ and 5′, then retrieved the sequences in the FASTA format. We used the RepeatMasker program ( http://www.repeatmasker.org http://www.repeatmasker.org ) to mask all human repeats in these sequences. To find out the up-regulation motifs, a program named MotifSampler ( http://bioinformatics.psb.ugent.be/webtools/plantcare/html/Motif_Sampler.html http://bioinformatics.psb.ugent.be/webtools/plantcare/html/Motif_Sampler.html ) was used (default parameters were applied). We used the WebLogo program ( http://weblogo.berkeley.edu/ http://weblogo.berkeley.edu/ ) (Crooks et al., 2004 2004 ) to calculate the consensus sequences. Gene ontology analysis 2 To analyze the enriched Gene Ontology (GO) terms of all evidence levels and categories statistically, we used the program High-Throughput GoMiner (Zeeberg et al., 2005 2005 ). Results 1 Specificity of the antibody 2 The specificity of the antibody is essential to the success of ChIP-seq experiments. We characterized the anti-OCT4 antibody used in our study using Western blot. The antibody recognized a distinct band of the appropriate size in glioblastoma cells (Fig. 1 1 ). (a) OCT4 protein in U251 cell lysate; (b) Immunoprecipitation (IP)-products using IgG and OCT4 antibodies ChIP-seq analysis of OCT4 binding regions in glioblastoma cells 2 To observe the genome-wide binding patterns of OCT4, a novel approach for the identification of TF binding sites, ChIP-seq technology, was applied (Barski et al., 2007 2007 ; Johnson et al., 2007 2007 ). From sequence analysis, we mapped a total of 217 688 and 421 892 sequence tags uniquely to the human genome (allowing two mismatches) for IgG and OCT4, respectively. MACS was then applied to analyze the enriched binding regions of OCT4. With a P -value of < 0.01, 5 438 OCT4 binding regions were identified in the human genome with IgG ChIP-seq as a negative control (Table S1 S1 ). We randomly picked ten genes and confirmed that all ten gene DNA binding regions were enriched in the OCT4 IP DNA compared to the IgG IP DNA, using real-time PCR (Fig. 2 2 ). This suggested that the false positive rate of our dataset was negligible. With 5 438 binding regions corresponding to 3 798 genes, our results suggested that on average there were 1.4 enriched regions per gene. Relative amounts of PCR products from OCT4 ChIP and IgG ChIP are shown as bar graphs with the amount of IgG ChIP normalized to 1. Standard deviations are also shown for OCT4 IP The OCT4 binding regions were mapped to the human genome (Table S1 S1 ) using database HG19 with a cutoff-value of 50 kb distance. We calculated the distance from the OCT4 binding region to the known genes’ TSSs and tabulated the frequency of OCT4 binding sites across the 5-kb distance interval before and after the TSSs. The OCT4 binding sites were around the TSSs, with about 41.05 % of binding sites mapped within a 5-kb distance (Fig. 3 3 ). We analyzed the function of OCT4 binding genes using the GoMiner program with Level 3 of the biology process. The enriched GO terms are shown in Table 2 2 . The top enriched terms included GO:0010467 gene expression, GO:0046907 intracellular transport, GO:0006886 intracellular protein transport, GO:0015031 protein transport, and GO:0006412 translation. Note that OCT4 regulated 338 of the 1 085 genes involved in gene expression of biological processes (GO:0010467), 56 of the 140 genes involved in gene translation (GO:0006412), and 133 of the 430 genes involved in apoptosis (GO:0006915). Frequencies of OCT4 island binding sites were calculated every 2 kb ( Y -axis). Relative distance to TSSs is shown on the X -axis, negative and positive values indicate localizations 5′ and 3′, respectively, to TSSs GO category Number of total genes Number of changed genes Enrichment lg P GO:0010467_gene_expression 1 085 338 1.201 −4.89743 GO:0046907_intracellular_transport 282 105 1.435 −4.89674 GO:0006886_intracellular_protein_transport 145 61 1.622 −4.85319 GO:0015031_protein_transport 160 63 1.518 −3.94681 GO:0006412_translation 140 56 1.542 −3.78437 GO:0006397_mRNA_processing 73 33 1.742 −3.56974 GO:0006396_RNA_processing 165 63 1.472 −3.50444 GO:0006986_response_to_unfolded_protein 30 17 2.184 −3.47247 GO:0051789_response_to_protein_stimulus 30 17 2.184 −3.47247 GO:0045184_establishment_of_protein_localization 189 70 1.428 −3.37452 GO:0006376_mRNA_splice_site_selection 12 9 2.891 −3.28214 GO:0006508_proteolysis 187 69 1.422 −3.28129 GO:0008380_RNA_splicing 88 37 1.621 −3.16857 GO:0042060_wound_healing 59 25 1.633 −2.37032 GO:0000375_RNA_splicing__via_transesterification_reactions 35 16 1.762 −2.05301 GO:0006915_apoptosis 430 133 1.192 −2.03365 GO:0002526_acute_inflammatory_response 11 7 2.453 −2.02957 GO:0009408_response_to_heat 11 7 2.453 −2.02957 GO:0051604_protein_maturation 11 7 2.453 −2.02957 GO:0006457_protein_folding 56 23 1.583 −2.02892 GO:0012501_programmed_cell_death 432 133 1.187 −1.96191 GO:0030162_regulation_of_proteolysis 9 6 2.570 −1.91899 GO:0051641_cellular_localization 377 117 1.196 −1.89567 GO:0008219_cell_death 442 135 1.177 −1.86254 Identification of DNA binding consensus sequences and OCT4-associated TFs in the OCT4 binding regions 2 We applied the program MotifSampler to identify the enriched and unique consensus sequences in the binding regions of human OCT4 in glioblastoma cells. A consensus sequence of TTTkswTw (w=A or T, k=T or G, s=C or G) with a very high log likelihood score (17 971.1) was found. The Table S2 S2 shows this consensus sequence’s output matrix and Table S3 S3 shows 3 931 instances of this motif in 2 312 OCT4 binding regions. The logo of the consensus sequence is shown in Fig. 4 4 . The MotifSampler program was used to systematically search for other known potential TFs which bind to the OCT4 binding regions and cooperate to regulate gene expression. All matrices of the TF’s motifs were scanned and the matched matrices were tabulated and calculated. Among the top known TF’s matrices identified as OCT cooperators, matching in more than 30% of cases, the hepatocyte nuclear factor ( HNF ) family, the fork head transcription factor ( FOX ) family, the OCT family, the sex-determining region of Y-chromosome ( SRY ) family, and several other TFs including CEBP , PIT1_Q6 , POU1F1_Q6 , and PBX1_01 (Table 3 3 ) were found. The over-represented sequences were used as input for the WebLogo program ( http://weblogo.berkeley.edu/ http://weblogo.berkeley.edu/ ) to display the consensus sequence graphically Known TF Number of occurrences Percentage of total sites (%)   SRY_01 6 039 61.14   CEBP_01 5 733 58.04   HNF3_Q6 5 508 55.76   POU1F1_Q6 4 359 44.13   FOX_Q2 4 222 42.74   GATA_Q6 3 857 39.05   SRY_02 3 841 38.88   NKX62_Q2 3 837 38.84   HFH3_01 3 780 38.27   PIT1_Q6 3 778 38.25   CEBP_Q2_01 3 762 38.08   STAT5A_04 3 595 36.39   TBP_01 3 593 36.37   CRX_Q4 3 573 36.17   DBP_Q6 3 556 36.00   STAT4_01 3 429 34.71   FREAC7_01 3 395 34.37   HNF1_Q6 3 378 34.20   TEF1_Q6 3 314 33.55   STAT5A_03 3 282 33.23   AML1_Q6 3 045 30.83 Discussion 1 Identification of the binding sites of TFs on the genome is important for understanding the mechanism of function of genes. ChIP-combined next-generation sequencing can identify physical interactions between proteins and DNA in living cells and provide a whole-genome view of protein-DNA interactions (Barski and Zhao, 2009 2009 ; Gilchrist et al., 2009 2009 ; Visel et al., 2009 2009 ). OCT4 has been considered as a major factor which could induce pluripotency in both mouse and human somatic cells. It plays a key role in the process of self-renewal and pluripotency. Recently, OCT4 was consistently detected in several cancers and was shown to be able to contribute to cancer processes including proliferation and invasion, and to the property of chemoradioresistance. The diverse functions of OCT4 in cancer suggested that we should study its target genes genome-wide. In the present study, we used ChIP-seq to identify OCT4 binding regions in human glioblastoma cancer cells and found that OCT4 binding regions were enriched for AT with a consensus sequence TTTkswTw. The consensus sequence of OCT4 binding regions is consistent with previous in vitro studies in stem cells (Williams et al., 2004 2004 ; Okumura-Nakanishi et al., 2005 2005 ; Tay et al., 2008 2008 ), which showed that the OCT4 protein binds DNA through AT-rich sequences with the motifs TTTGCwT (w=T or A). Marson et al. ( 2008 2008 ) used ChIP-seq to identify binding regions of OCT4, SOX2, NANOG, and TCF3, and discovered that these four factors co-occupy 14 230 sites in the genome. They showed that about 25% of binding sites were within 8 kb of the TSSs of 3 289 annotated genes, 25% were within genes with a distance of more than 8 kb to the TSSs, and almost 50% occurred in intergenic regions far away from annotated start sites. In our study, we found that about 66.79% of OCT4 binding regions (3 632 of 5 438) mapped within 8 kb of the TSSs and about 42.72% (2 323 binding regions) mapped within 2 kb of the TSSs in glioblastoma cancer cells. ChIP-seq technology has been applied to the identification of target genes of OCT4 , SOX2 , and NANOG in human embryonic stem cells by Boyer et al. ( 2005 2005 ). They identified 605 of the OCT4 binding promoter regions for known protein-coding genes in human embryonic stem cells. In our study, we found that 279 regions corresponding to 93 genes overlapped with our data. This suggests that the genes that are regulated by OCT4 are conserved in embryonic stem cells and brain tumor cells. Previous studies suggested that the OCT4 protein could either activate or repress specific target genes through interaction with different partner proteins such as SOX2 and NANOG (Tay et al., 2008 2008 ). OCT4 target specificity may depend on its interacting proteins, which may include other TFs, co-activators, repressors and other proteins. These interacting proteins may interact with OCT4 to modulate OCT4’s role as a TF. In the present study, we searched for the potential known TF binding motif in OCT4 binding regions. These TFs may act as OCT4 cooperators and regulate expression of many genes together with OCT4 in glioblastoma cancer. The enriched analysis of GO terms suggested that OCT4 is involved in some important biological processes, including gene expression (GO:0010467), translation (GO:0006412), mRNA processing (GO:0006397), wound healing (GO:0042060), and apoptosis (GO:0006915). In summary, our genome-wide analysis of protein-DNA interaction in glioblastoma cells may help to explain the role of OCT4 in glioblastoma carcinogenesis. References Y Atlasi , SJ Mowla , SA Ziaee , AR Bahrami . OCT-4 , an embryonic stem cell marker, is highly expressed in bladder cancer . Int J Cancer , 2007 . 120 ( 7 ): 1598 - 1602 . 17205510 DOI: 10.1002/ijc.22508 http://doi.org/10.1002/ijc.22508 . OCT-4, an embryonic stem cell marker, is highly expressed in bladder cancer A Barski , K Zhao . Genomic location analysis by ChIP-seq . J Cell Biochem , 2009 . 107 ( 1 ): 11 - 18 . 19173299 DOI: 10.1002/jcb.22077 http://doi.org/10.1002/jcb.22077 . Genomic location analysis by ChIP-seq A Barski , S Cuddapah , K Cui , TY Roh , DE Schones , Z Wang , G Wei , I Chepelev , K Zhao . High-resolution profiling of histone methylations in the human genome . Cell , 2007 . 129 ( 4 ): 823 - 837 . 17512414 DOI: 10.1016/j.cell.2007.05.009 http://doi.org/10.1016/j.cell.2007.05.009 . High-resolution profiling of histone methylations in the human genome LA Boyer , TI Lee , MF Cole , SE Johnstone , SS Levine , JP Zucker , MG Guenther , RM Kumar , HL Murray , RG Jenner , 等 . Core transcriptional regulatory circuitry in human embryonic stem cells . Cell , 2005 . 122 ( 6 ): 947 - 956 . 16153702 DOI: 10.1016/j.cell.2005.08.020 http://doi.org/10.1016/j.cell.2005.08.020 . Core transcriptional regulatory circuitry in human embryonic stem cells YC Chen , HS Hsu , YW Chen , TH Tsai , CK How , CY Wang , SC Hung , YL Chang , ML Tsai , YY Lee , 等 . Oct-4 expression maintained cancer stem-like properties in lung cancer-derived CD133-positive cells . PLoS One , 2008 . 3 ( 7 ): e2637 18612434 DOI: 10.1371/journal.pone.0002637 http://doi.org/10.1371/journal.pone.0002637 . Oct-4 expression maintained cancer stem-like properties in lung cancer-derived CD133-positive cells CJ Cheng , YC Wu , JA Shu , TY Ling , HC Kuo , JY Wu , EE Chang , SC Chang , YH Huang . Aberrant expression and distribution of the OCT-4 transcription factor in seminomas . J Biomed Sci , 2007 . 14 ( 6 ): 797 - 807 . 17682839 DOI: 10.1007/s11373-007-9198-7 http://doi.org/10.1007/s11373-007-9198-7 . Aberrant expression and distribution of the OCT-4 transcription factor in seminomas GE Crooks , G Hon , JM Chandonia , SE Brenner . WebLogo: a sequence logo generator . Genome Res , 2004 . 14 ( 6 ): 1188 - 1190 . 15173120 DOI: 10.1101/gr.849004 http://doi.org/10.1101/gr.849004 . WebLogo: a sequence logo generator N Dekker , M Cox , R Boelens , CP Verrijzer , PC van der Vliet , R Kaptein . Solution structure of the POU-specific DNA-binding domain of Oct-1 . Nature , 1993 . 362 ( 6423 ): 852 - 855 . 8479524 DOI: 10.1038/362852a0 http://doi.org/10.1038/362852a0 . Solution structure of the POU-specific DNA-binding domain of Oct-1 X Fang , W Yu , L Li , J Shao , N Zhao , Q Chen , Z Ye , SC Lin , S Zheng , B Lin . ChIP-seq and functional analysis of the SOX2 gene in colorectal cancers . OMICS , 2010 . 14 ( 4 ): 369 - 384 . 20726797 DOI: 10.1089/omi.2010.0053 http://doi.org/10.1089/omi.2010.0053 . ChIP-seq and functional analysis of the SOX2 gene in colorectal cancers X Fang , J Yoon , L Li , W Yu , J Shao , D Hua , S Zheng , L Hood , DR Goodlett , G Foltz , 等 . The SOX2 response program in glioblastoma multiforme: an integrated ChIP-seq, expression microarray, and microRNA analysis . BMC Genomics , 2011 . 12 ( 1 ): 11 21211035 DOI: 10.1186/1471-2164-12-11 http://doi.org/10.1186/1471-2164-12-11 . The SOX2 response program in glioblastoma multiforme: an integrated ChIP-seq, expression microarray, and microRNA analysis DA Gilchrist , DC Fargo , K Adelman . Using ChIP-chip and ChIP-seq to study the regulation of gene expression: genome-wide localization studies reveal widespread regulation of transcription elongation . Methods , 2009 . 48 ( 4 ): 398 - 408 . 19275938 DOI: 10.1016/j.ymeth.2009.02.024 http://doi.org/10.1016/j.ymeth.2009.02.024 . Using ChIP-chip and ChIP-seq to study the regulation of gene expression: genome-wide localization studies reveal widespread regulation of transcription elongation W Herr , MA Cleary . The POU domain: versatility in transcriptional regulation by a flexible two-in-one DNA-binding domain . Genes Dev , 1995 . 9 ( 14 ): 1679 - 1693 . 7622033 DOI: 10.1101/gad.9.14.1679 http://doi.org/10.1101/gad.9.14.1679 . The POU domain: versatility in transcriptional regulation by a flexible two-in-one DNA-binding domain H Ji , H Jiang , W Ma , DS Johnson , RM Myers , WH Wong . An integrated software system for analyzing ChIP-chip and ChIP-seq data . Nat Biotechnol , 2008 . 26 ( 11 ): 1293 - 1300 . 18978777 DOI: 10.1038/nbt.1505 http://doi.org/10.1038/nbt.1505 . An integrated software system for analyzing ChIP-chip and ChIP-seq data DS Johnson , A Mortazavi , RM Myers , B Wold . Genome-wide mapping of in vivo protein-DNA interactions . Science , 2007 . 316 ( 5830 ): 1497 - 1502 . 17540862 DOI: 10.1126/science.1141319 http://doi.org/10.1126/science.1141319 . Genome-wide mapping of in vivo protein-DNA interactions JB Kim , B Greber , MJ Arauzo-Bravo , J Meyer , KI Park , H Zaehres , HR Scholer . Direct reprogramming of human neural stem cells by OCT4 . Nature , 2009 . 461 ( 7264 ): 643 - 649 . DOI: 10.1038/nature08436 http://doi.org/10.1038/nature08436 . Direct reprogramming of human neural stem cells by OCT4 JB Kim , V Sebastiano , G Wu , MJ Arauzo-Bravo , P Sasse , L Gentile , K Ko , D Ruau , M Ehrich , D van den Boom , 等 . Oct4-induced pluripotency in adult neural stem cells . Cell , 2009 . 136 ( 3 ): 411 - 419 . 19203577 DOI: 10.1016/j.cell.2009.01.023 http://doi.org/10.1016/j.cell.2009.01.023 . Oct4-induced pluripotency in adult neural stem cells HJ Kraft , S Mosselman , HA Smits , P Hohenstein , E Piek , Q Chen , K Artzt , EJ van Zoelen . Oct-4 regulates alternative platelet-derived growth factor α receptor gene promoter in human embryonal carcinoma cells . J Biol Chem , 1996 . 271 ( 22 ): 12873 - 12878 . 8662786 DOI: 10.1074/jbc.271.22.12873 http://doi.org/10.1074/jbc.271.22.12873 . Oct-4 regulates alternative platelet-derived growth factor α receptor gene promoter in human embryonal carcinoma cells B Lin , J Wang , X Hong , X Yan , D Hwang , JH Cho , D Yi , AG Utleg , X Fang , DE Schones , 等 . Integrated expression profiling and ChIP-seq analyses of the growth inhibition response program of the androgen receptor . PLoS One , 2009 . 4 ( 8 ): e6589 19668381 DOI: 10.1371/journal.pone.0006589 http://doi.org/10.1371/journal.pone.0006589 . Integrated expression profiling and ChIP-seq analyses of the growth inhibition response program of the androgen receptor A Marson , SS Levine , MF Cole , GM Frampton , T Brambrink , S Johnstone , MG Guenther , WK Johnston , M Wernig , J Newman , 等 . Connecting microRNA genes to the core transcriptional regulatory circuitry of embryonic stem cells . Cell , 2008 . 134 ( 3 ): 521 - 533 . 18692474 DOI: 10.1016/j.cell.2008.07.020 http://doi.org/10.1016/j.cell.2008.07.020 . Connecting microRNA genes to the core transcriptional regulatory circuitry of embryonic stem cells M Monk , C Holding . Human embryonic genes re-expressed in cancer cells . Oncogene , 2001 . 20 ( 56 ): 8085 - 8091 . 11781821 DOI: 10.1038/sj.onc.1205088 http://doi.org/10.1038/sj.onc.1205088 . Human embryonic genes re-expressed in cancer cells S Okumura-Nakanishi , M Saito , H Niwa , F Ishikawa . Oct-3/4 and Sox2 regulate Oct-3/4 gene in embryonic stem cells . J Biol Chem , 2005 . 280 ( 7 ): 5307 - 5317 . 15557334 DOI: 10.1074/jbc.M410015200 http://doi.org/10.1074/jbc.M410015200 . Oct-3/4 and Sox2 regulate Oct-3/4 gene in embryonic stem cells M Pesce , X Wang , DJ Wolgemuth , H Scholer . Differential expression of the Oct-4 transcription factor during mouse germ cell differentiation . Mech Dev , 1998 . 71 ( 1-2 ): 89 - 98 . 9507072 DOI: 10.1016/S0925-4773(98)00002-1 http://doi.org/10.1016/S0925-4773(98)00002-1 . Differential expression of the Oct-4 transcription factor during mouse germ cell differentiation J Schoorlemmer , L Jonk , S Sanbing , A van Puijenbroek , A Feijen , W Kruijer . Regulation of Oct-4 gene expression during differentiation of EC cells . Mol Biol Rep , 1995 . 21 ( 3 ): 129 - 140 . 8832901 DOI: 10.1007/BF00997235 http://doi.org/10.1007/BF00997235 . Regulation of Oct-4 gene expression during differentiation of EC cells E Schreiber , RE Merchant , OD Wiestler , A Fontana . Primary brain tumors differ in their expression of octamer deoxyribonucleic acid-binding transcription factors from long-term cultured glioma cell lines . Neurosurgery , 1994 . 34 ( 1 ): 129 - 135 . 8121549 DOI: 10.1227/00006123-199401000-00019 http://doi.org/10.1227/00006123-199401000-00019 . Primary brain tumors differ in their expression of octamer deoxyribonucleic acid-binding transcription factors from long-term cultured glioma cell lines K Takahashi , S Yamanaka . Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors . Cell , 2006 . 126 ( 4 ): 663 - 676 . 16904174 DOI: 10.1016/j.cell.2006.07.024 http://doi.org/10.1016/j.cell.2006.07.024 . Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors K Takahashi , K Tanabe , M Ohnuki , M Narita , T Ichisaka , K Tomoda , S Yamanaka . Induction of pluripotent stem cells from adult human fibroblasts by defined factors . Cell , 2007 . 131 ( 5 ): 861 - 872 . 18035408 DOI: 10.1016/j.cell.2007.11.019 http://doi.org/10.1016/j.cell.2007.11.019 . Induction of pluripotent stem cells from adult human fibroblasts by defined factors Y Tay , J Zhang , AM Thomson , B Lim , I Rigoutsos . MicroRNAs to Nanog , Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation . Nature , 2008 . 455 ( 7216 ): 1124 - 1128 . 18806776 DOI: 10.1038/nature07299 http://doi.org/10.1038/nature07299 . MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation CP Verrijzer , MJ Alkema , WW van Weperen , HC van Leeuwen , MJ Strating , PC van der Vliet . The DNA binding specificity of the bipartite POU domain and its subdomains . EMBO J , 1992 . 11 ( 13 ): 4993 - 5003 . 1361172 . The DNA binding specificity of the bipartite POU domain and its subdomains A Visel , MJ Blow , Z Li , T Zhang , JA Akiyama , A Holt , I Plajzer-Frick , M Shoukry , C Wright , F Chen , 等 . ChIP-seq accurately predicts tissue-specific activity of enhancers . Nature , 2009 . 457 ( 7231 ): 854 - 858 . 19212405 DOI: 10.1038/nature07730 http://doi.org/10.1038/nature07730 . ChIP-seq accurately predicts tissue-specific activity of enhancers W Wang , P Zhang , X Liu . Short read DNA fragment anchoring algorithm . BMC Bioinformatics , 2009 . 10 ( s1 ): S17 19208116 DOI: 10.1186/1471-2105-10-S1-S17 http://doi.org/10.1186/1471-2105-10-S1-S17 . Short read DNA fragment anchoring algorithm DCJr Williams , M Cai , GM Clore . Molecular basis for synergistic transcriptional activation by Oct1 and Sox2 revealed from the solution structure of the 42-kDa Oct1.Sox2. Hoxb1 -DNA ternary transcription factor complex . J Biol Chem , 2004 . 279 ( 2 ): 1449 - 1457 . 14559893 DOI: 10.1074/jbc.M309790200 http://doi.org/10.1074/jbc.M309790200 . Molecular basis for synergistic transcriptional activation by Oct1 and Sox2 revealed from the solution structure of the 42-kDa Oct1.Sox2.Hoxb1-DNA ternary transcription factor complex J Yu , MA Vodyanik , K Smuga-Otto , J Antosiewicz-Bourget , JL Frane , S Tian , J Nie , GA Jonsdottir , V Ruotti , R Stewart , 等 . Induced pluripotent stem cell lines derived from human somatic cells . Science , 2007 . 318 ( 5858 ): 1917 - 1920 . 18029452 DOI: 10.1126/science.1151526 http://doi.org/10.1126/science.1151526 . Induced pluripotent stem cell lines derived from human somatic cells BR Zeeberg , H Qin , S Narasimhan , M Sunshine , H Cao , DW Kane , M Reimers , RM Stephens , D Bryant , SK Burt , 等 . High-throughput GoMiner, an ‘industrial-strength’ integrative gene ontology tool for interpretation of multiple-microarray experiments, with application to studies of Common Variable Immune Deficiency (CVID) . BMC Bioinformatics , 2005 . 6 ( 1 ): 168 15998470 DOI: 10.1186/1471-2105-6-168 http://doi.org/10.1186/1471-2105-6-168 . High-throughput GoMiner, an ‘industrial-strength’ integrative gene ontology tool for interpretation of multiple-microarray experiments, with application to studies of Common Variable Immune Deficiency (CVID) 10.1631/jzus.B1100059 Project supported by the Ministry of Science and Technology, China (Nos. 2004CB518707, 2006DFA32950, 2006AA02Z4A2, 2006AA02 A303, 2007DFC30360, and 2008DFA11320), and the National Natural Science Foundation of China (No. 81101580) 2011-03-01 2011-09-13 2011-06-02 2022-01-05 Copyright © Zhejiang University and Springer-Verlag Berlin Heidelberg 2011 2011 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 10 12