Influence of heat stress on leaf ultrastructure, photosynthetic performance, and ascorbate peroxidase gene expression of two pear cultivars (Pyrus pyrifolia)

Influence of heat stress on leaf ultrastructure, photosynthetic performance, and ascorbate peroxidase gene expression of two pear cultivars ( Pyrus pyrifolia ) 1 first-author 2 1 1 1 corresp ‡Corresponding Author ‡Corresponding Author †E-mail:ywteng@zju.edu.cn †E-mail:ywteng@zju.edu.cn ywteng@zju.edu.cn State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Department of Horticulture, Zhejiang University, Hangzhou 310058, China State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Department of Horticulture, Zhejiang University, Hangzhou 310058, China College of Horticulture, Northwest A&F University, Yangling 712100, China College of Horticulture, Northwest A&F University, Yangling 712100, China Plants encounter a variety of stresses in natural environments. One-year-old pot-grown trees of pear ( Pyrus pyrifolia Nakai cv. Cuiguan and Wonhwang) were exposed to two heat stress regimes. Under constant short-term heat stress, chloroplasts and mitochondria were visibly damaged. Relative chlorophyll content and maximum photochemical efficiency of photosystem II were significantly decreased, which indicated that the leaf photosynthetic capability declined. Under chronic heat stress, mesophyll cell ultrastructure was not obviously damaged, but leaf photosynthetic capability was still restrained. As chronic heat stress was a simulation of the natural environment in summer, further study of the responses under this stress regime was undertaken. Ascorbate peroxidase (APX) activity was increased in ‘Cuiguan’, but not in ‘Wonhwang’. Inducible expression of PpAPX genes in the cytoplasm, chloroplasts and peroxisomes was consistent with increased APX activity in ‘Cuiguan’, whereas only weak induction of PpAPX genes was observed in ‘Wonhwang’. The isoenzymes cytosolic APX1 (cAPX1) and stromal APX (sAPX) were confirmed to be localized in the cytoplasm and chloroplasts, respectively. Pear Ultrastructure Ascorbate peroxidase Subcellular localization Synergistic effect Introduction 1 Chinese sand pear ( Pyrus pyrifolia Nakai) is an economically important fruit species and is cultivated widely in China. In the context of global climate change, increasing frequency and duration of extremely high temperature have exerted a negative impact on fruit production in the pear industry via effects such as leaf scorch, decreased flower bud formation, and abnormal flowering (Glenn et al., 2002 2002 ; Li and Cheng, 2009 2009 ; Huang et al., 2010 2010 ; Wang et al., 2011 2011 ). As sessile organisms, plants have evolved a powerful mechanism for adaptation to extreme temperature (Bohnert et al., 1995 1995 ). The antioxidant system is a universal and important protective pathway because almost all abiotic stresses generate reactive oxygen species (ROS) (Foyer et al., 1994 1994 ; Asada, 1999 1999 ; Mittler et al., 2004 2004 ). Excess ROS can attack proteins, lipids, or nucleic acids, and ultimately lead to injury symptoms (Fridovich, 1998 1998 ; Karpinski et al., 1999 1999 ; Vanderauwera et al., 2011 2011 ). Chloroplasts and mitochondria are the predominant sites of ROS generation because of their high concentration of oxygen and they are easily damaged under stress conditions (Mittler et al., 2004 2004 ; Asada, 2006 2006 ). Hydrogen peroxide (H 2 O 2 ) is considered extremely harmful among ROS because it is easily diffused and converted to ∙OH (Bienert et al., 2007 2007 ). However, H 2 O 2 also functions as a signal molecule in important physiological processes (Dat et al., 2000 2000 ; Mittler, 2002 2002 ; Neill et al., 2002 2002 ; Vandenabeele et al., 2003 2003 ; Apel and Hirt, 2004 2004 ; Mullineaux, 2006 2006 ). H 2 O 2 induces expression of small heat shock protein genes and activates heat shock transcription factors under heat stress (Volkov et al., 2006 2006 ). Moreover, H 2 O 2 arouses defense responses in unstressed regions as a systemic signal (Karpinski et al., 1999 1999 ). Thus, dissipation of excess H 2 O 2 is essential owing to its dual roles. In contrast to annuals, perennial fruit trees have a more complex branching structure, in which the shading of leaves may be beneficial for stress adaptation, but high leaf density also potentially aggravates stress. In our previous study, the different responses of the P. pyrifolia cultivars ‘Cuiguan’ and ‘Wonhwang’ to environmental stress were reported (Ji et al., 2012 2012 ). In the present study, the two cultivars were chosen to study their thermal performance under high temperature treatment. Materials and methods 1 Plant materials and treatments 2 Experiment 1: constant short-term heat stress regime 3 One-year-old P. pyrifolia cv. Cuiguan (CG) and Wonhwang (WH) trees were planted in 53-L pots and tended in accordance with standard fertilization and pest-control practices outdoors. In July, six trees of each cultivar were transferred to a growth chamber for constant short-term heat stress treatment. Three trees of each cultivar were grown under a constant high temperature of 40 °C for 2 d and three trees were cultivated at 27 °C (the control). The illumination was 75% natural sunlight and relative humidity was 60%–70%. After treatment for 2 d, leaves were harvested for observation of the mesophyll cell ultrastructure. Relative chlorophyll content was measured with a SPAD meter (SPAD-502, Minolta, Japan), and maximum photosystem II (PSII) photochemical efficiency (the ratio of variable to maximum fluorescence, F v / F m ) of leaves was measured before and at completion of short-term heat stress treatment. Experiment 2: chronic heat stress regime 3 An additional six trees of each cultivar were selected for chronic heat stress treatment. Three trees of each cultivar were cultivated at 40 °C from 11:00 to 17:00 and at 27 °C for the remainder of the day, while three trees were grown at a constant temperature of 27 °C (the control). The other growing conditions were identical to those of Experiment 1. After treatment for 6 d, leaves were harvested for observation of the mesophyll cell ultrastructure, and all trees were transferred to field conditions for recovery. F v / F m was measured daily at 10:00 before the increase in temperature. On the last day of treatment, the net photosynthetic rate ( P n ) was measured at 11:00 to evaluate the influence of chronic heat stress on leaf photosynthetic capacity. After recovery for 6 d in the field, P n was measured again to evaluate the recovery capability of the photosynthetic apparatus. During chronic heat stress treatment, healthy leaves were sampled daily, frozen in liquid N 2 , and stored at −80 °C for analyses of enzyme activity and gene expression. Observation of mesophyll cell ultrastructure 2 Fresh leaves were sliced and fixed in 2.5% glutaraldehyde for 12 h at 4 °C. After washing in 100 mmol/L phosphate buffer (pH 7.0) and fixing in 1% (0.01 g/ml) osmium tetroxide, the leaf slices were dehydrated, embedded in Epon-812 resin and stained with uranyl acetate and lead citrate. Ultrathin sections (80 nm) were prepared and observed with a transmission electron microscope (JEOL, Japan) at 80 kV. The numbers of normal and deformed chloroplasts in Experiment 1 were counted in micrographs of 30 mesophyll cells. Evaluation of leaf photosynthetic capacity 2 The F v / F m ratio was measured with a chlorophyll fluorometer (Walz, Germany). After dark adaptation for 20 min, three leaves were detached and transferred to room temperature for measurement. The measurement light intensity was 0.12 μmol/(m 2 ·s) for measurement of the dark-adapted minimum fluorescence yield ( F o ) and a saturating pulse of 5 000 μmol/(m 2 ·s) at 0.8 s intervals for measurement of the dark-adapted maximal fluorescence yield ( F m ). The F v / F m ratio was calculated as F v / F m =( F m − F o )/ F m . P n was measured with a Li-6400 photosynthesis system (Li-COR, USA); the measurement parameters were 800 μmol/(m 2 ·s) light intensity and 400 μmol/mol CO 2 . Relative chlorophyll content was measured with a SPAD-502 portable leaf greenness meter (Minolta, Japan). Assay of lipid peroxidation content and ascorbate peroxidase activity 2 Malondialdehyde (MDA) content in leaf was determined with the method described by Heath and Packer ( 1968 1968 ). Activity of ascorbate peroxidase (APX) was determined in accordance with the method described by Nakano and Asada ( 1981 1981 ) with slight modification. Ground leaf tissue (0.5 g) was added to 100 mmol/L potassium phosphate buffer (pH 7.8) containing 2 mmol/L ethylenediaminetetraacetic acid disodium salt (EDTA), 5 mmol/L ascorbate, and 2% (0.02 g/ml) polyvinyl pyrrolidone, and then centrifuged at 14 000× g for 10 min at 4 °C. Oxidation of ascorbate was initiated by addition of H 2 O 2 , and the absorbance at 290 nm was dynamically monitored for 1 min. One unit of APX activity was defined as an absorbance change of 0.01 per minute. Gene clone and sequence analysis 2 Total RNA was extracted from CG leaves. Digested RNA treated with DNase I was reverse-transcribed using the Revert Aid™ First Strand cDNA Synthesis Kit (Fermentas, USA). Primers for cloning the APX gene (Table 1 1 ) were designed based on conserved regions or transcriptome data (Liu et al., 2012 2012 ). After obtaining partial sequences, the flanking sequence was amplified by nest-polymerase chain reaction (PCR) using the SMART RACE cDNA Amplification Kit (Clontech, USA). Amino acid sequences were deduced with the online ORF Finder tool ( http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi ). Nucleotide sequences of other plant APX genes (Panchuk et al., 2002 2002 ; Teixeira et al., 2004 2004 ; Najami et al., 2008 2008 ; Sečenji et al., 2009 2009 ) were retrieved from the National Center for Biotechnology Information (NCBI) databases. A dendrogram was constructed using the neighbor-joining method with MEGA 5.0 software. Bootstrap support values (from an analysis with 1 000 replicates) were denoted at each node. Gene Primer (5′–3′) Product size (bp) 2 Gene cloning PpcAPX1 Forward: ACATGGGGCACTCACTCTCC 1 070 Reverse: GCTTTATTCAATCTACAAGG PpcAPX2 Forward: ACATGGGGGTGCCACTCCATAG 1 070 Reverse: GAAGTGAAAATTACAGTAT PpcAPX3 Forward: TTAGATATCCATTTTGATGTG 1 163 Reverse: ACCTCTGACATTACATTCGT PppAPX Forward: AAAACCACATCTGTCCAGCT 1 155 Reverse: CATGTCACTATGTCCGTCGT PpsAPX Forward: ATCTGTCCATTTTCCAAATC 1 577 Reverse: TTGATAGCAATGTAATTCTCAT PptAPX Forward: GCCCCACCATTGGGGTGGAA 1 009 Reverse: GGAAATGCAACATTACAAGG 3 2 Quantification PpcAPX1 Forward: GGAGAACCAAAAGGGATGATG 204 Reverse: GAATTGAAAATGACGGCTTTA PpcAPX2 Forward: CGCGCCTTGCTTTTGTTT 192 Reverse: TAATACTGTAATTTTCACTTC PpcAPX3 Forward: TCCAGTCTTTCGCCCTCT 132 Reverse: CTACAAATCACAATCCCTTA PppAPX Forward: CGATACTGGCACAAGGAG 179 Reverse: ATTCGTAAGGGATCAAGG PpsAPX Forward: CATGCTTACTTGTGCCATCTG 206 Reverse: AGAGGCTTATCTGGGCTTCC PptAPX Forward: CTTTGGGCCAACAAATCAAT 201 Reverse: GACGCAGTTTTGAAGAGATGC 3 2 Subcellular localization PpcAPX1 Forward: GGGGTACCACATGGGGCACTCACTCTCCATCGC 833 Reverse: CGGGATCCGGCCTCAGCAAACCCGAGCTCAGAG PpsAPX Forward: GGGGTACCAGCCATCTGTCCATTTTCCA 1 233 Reverse: CGGGATCCCTCCTTGCCAGATGAGTATTTGGC Subcellular localization of PpcAPX1 and PpsAPX 2 The open reading frames with a mutated terminator for PpcAPX1 and PpsAPX were cloned into the pMD18T-vector (TaKaRa, Japan) using primers with restriction enzyme sites and a protective base pair for Kpn I and Bam HI at the 5′ terminus. The primers are listed in Table 1 1 . Clone products and the pCHF3-GFP vector were double-digested by Kpn I and Bam HI (TaKaRa, Japan). The recombinant plasmid was transformed into Agrobacterium tumefaciens strain EHA105 and transiently expressed in Nicotiana benthamiana (Sparkes et al., 2006 2006 ). Infiltrated leaves were observed with a confocal laser scanning microscope (Zeiss, Germany). Excitation and emission wavelengths for the green fluorescence protein (GFP) were 488 nm and 505–530 nm, respectively. Images were processed with ZEN 2009 Light Edition software. Quantitative real-time PCR 2 The primers used for quantitative real-time PCR (qRT-PCR) (Table 1 1 ) were designed on the basis of the 3′-untranslated region sequence. The product length was no more than 210 bp. An identical product was amplified in both pear cultivars, primer specificity was confirmed by obtaining a single melting-curve peak, and a single band was visualized with agarose gel electrophoresis. The total reaction volume for qRT-PCR was 15 μl, which comprised 7.5 μl SYBR Green PCR Supermix (TaKaRa, Japan), 0.5 μl each primer, 1 μl of 1:10 (v/v) diluted cDNA, and 5.5 μl ddH 2 O 2 . The amplification procedure comprised denaturation for 5 min at 94 °C, 45 cycles of 94 °C for 10 s and 60 °C for 30 s, and was conducted with a Roche LightCycler® 480 (Roche, Germany). PpActin (JN684184) was used as a housekeeping gene (Yu et al., 2012 2012 ). Relative gene expression levels were calculated by the 2 −ΔΔ C T method (Livak and Schmittgen, 2001 2001 ). Statistical analysis 2 Statistical analyses were performed using the least-significant difference (LSD) test at the P < 0.05 significance level with SPSS 13.0 software. Results 1 Effect of constant short-term heat stress on mesophyll cell ultrastructure and photosynthetic performance of leaves 2 Damage from constant short-term heat stress was observed in chloroplasts, mitochondria, and the nucleus of mesophyll cells. In non-stressed cells, chloroplasts were elliptic or spindle-shaped, contained plump white starch grains, and were located adjacent to the cell wall. In the nucleus, chromatin was equally dispersed without aggregation. Under high-power magnification, stacked thylakoids and rod-like mitochondrial cristae were evident (Figs. 1 1 and 2 2 ). After constant short-term heat stress, the chloroplasts were swollen and were displaced from the cell wall. In the nucleus, chromatin was agglutinated with heterochromatin. Under high-power magnification, the thylakoids and mitochondrial cristae were swollen, ruptured, or had disappeared (Figs. 1 1 and 2 2 ). The percentage of deformed chloroplasts in heat-stressed leaves was 55% in CG and 57% in WH (Table 2 2 ). The relative chlorophyll content and F v / F m decreased after constant short-term heat stress in both cultivars (Fig. 3 3 ). Performances of cells (a), nucleus (b), thylakoids (c), and mitochondrion (d) under control or heat stress conditions. Cw: cell wall; Nu: nucleus; Cp: chloroplast; Th: thylakoids; Sl: stroma lamellae; Nm: nuclear membrane; Ch: chromatin; Sg: starch grain; Og: osmiophilic globule; Ld: lipid droplet; Is: intercellular space; Mi: mitochondrion; Mc: mitochondrial cristae Performances of cells (a), nucleus (b), thylakoids (c), and mitochondrion (d) under control or heat stress conditions. All the abbreviations are the same as those illustrated in Fig. 1 1 2 Treatment 2 Cuiguan 2 Wonhwang Normal Deformed Normal Deformed Control 0.91±0.02 0.09±0.02 0.86±0.01 0.14±0.01 Heat stress 0.45±0.06 0.55±0.06 0.43±0.02 0.57±0.02 5 P value <0.01 <0.01 <0.01 <0.01 The values represent the mean of three experiments±standard error. Asterisks indicate a significant difference between the control (Con) and heat stress treatment (HT) at P < 0.05 Effect of chronic heat stress on mesophyll cell ultrastructure and photosynthetic performance of leaves 2 Damage from chronic heat stress on mesophyll cell ultrastructure was less severe than that induced by constant heat stress in both cultivars. Chloroplasts, mitochondria, and the nucleus showed a normal appearance after chronic heat stress (Figs. 4 4 and 5 5 ). However, photosynthetic performance was affected by chronic heat stress. F v / F m of healthy leaves decreased but was still above 0.82 (Fig. 6 6 ), whereas F v / F m of visibly damaged leaves was less than 0.2 (data not shown). P n significantly decreased at completion of chronic heat stress treatment but, after 6 d of recovery in the field, P n of treated trees increased and attained a similar level to that of control trees (Fig. 6 6 ). However, after 6 d recovery in the field, P n of control trees was significantly lower than that recorded in the growth chamber, which may be due to suboptimal conditions during the hot summer. Performances of cells (a), nucleus (b), thylakoids (c), and mitochondrion (d) under control or heat stress conditions. All the abbreviations are the same as those illustrated in Fig. 1 1 Performances of cells (a), nucleus (b), thylakoids (c), and mitochondrion (d) under control or heat stress conditions. All the abbreviations are the same as those illustrated in Fig. 1 1 The values represent the mean of three experiments±standard error. Asterisks indicate a significant difference between the control (Con) and heat stress treatment (HT) at P < 0.05 Influence of chronic heat stress on lipid peroxidation and APX activity 2 After chronic heat-stress treatment, MDA content in the leaves significantly increased in both cultivars, and was higher in WH than in CG both before and after heat stress treatment (Fig. 7 7 ). The percentage increase in CG (24%) was lower than that in WH (28%). Activity of APX was significantly increased in CG at 4 and 5 d of chronic heat stress treatment, whereas no significant change in APX activity was observed in WH (Fig. 7 7 ). The values represent the mean of three experiments±standard error. Asterisks indicate a significant difference between the control (Con) and heat stress treatment (HT) at P < 0.05 Isolation, characterization, and subcellular localization of PpAPX genes 2 Six PpAPX genes were isolated from CG leaves and were designated as PpcAPX1 (JX104652), PpcAPX2 (JX104653), PpcAPX3 (JX104654), PppAPX4 (JX104655), PpsAPX (JX104656), and PptAPX (JX104657), respectively. The deduced protein was putatively localized in the cytoplasm, peroxisomes, or chloroplasts by PSORT Server ( http://psort.hgc.jp/ http://psort.hgc.jp/ ) and TargetP 1.1 Server ( http://www.cbs.dtu.dk/services/TargetP/ http://www.cbs.dtu.dk/services/TargetP/ ). In the neighbor-joining dendrogram, the genes were grouped into three main clusters, consistent with their subcellular localization (Fig. 8 8 ). The cytosolic APXs shared a high level of sequence identity (83%), and identities between subgroups were lower (32%–67%). The identity between cytosolic and peroxisomal APXs was higher than that between the chloroplastic APX and either peroxisomal or cytosolic APX. The peroxisomal APX isoenzyme was predicted to have a transmembrane helix at the C-terminus, and the 22-amino-acid core region of the transmembrane helix was located from positions 260 to 281 in the amino acid sequence, as predicted by the TMpred tool ( http://www.ch.embnet.org/software/TMPRED_form.html http://www.ch.embnet.org/software/TMPRED_form.html ). The stromal APX isoenzyme was predicted to have a chloroplast transit peptide (87 amino acids in length) at the N-terminus with the ChloroP Server ( http://www.cbs.dtu.dk/services/ChloroP/ http://www.cbs.dtu.dk/services/ChloroP/ ). At: Arabidopsis thaliana ( cAPX1 : NM_001123772; cAPX2 : NM_111798; pAPX1 : NM_119666; pAPX2 : NM_119763; sAPX : NM_001084887; tAPX : NM_106398); Os: Oryza sativa ( cAPX1 : D45423; cAPX2 : AB053297; pAPX1 : AK070842; pAPX2 : 3AY382617; sAPX1 : AK061107; sAPX2 : AK103344; tAPX : AB114856); Le: Lycopersicon esculentum ( cAPX1 : DQ096286; cAPX2 : DQ096287; cAPX3 : DQ131129; pAPX4 : ABA10744; pAPX5 : ABA10745; tAPX6 : DQ131132; sAPX7 : DQ131133); Ta: Triticum aestivum ( tAPX : AY513262; pAPX : EF555121); St: Solanum tuberosum (AB041343); Md: Malus domestica (EF528482); Vv: Vitis vinifera ( cAPX : EU280159); Pp: Pyrus pyrifolia ( cAPX1 : JX104652; cAPX2 : JX104653; cAPX3 : JX104654; pAPX : JX104655; sAPX : JX104656; tAPX : JX104657) Subcellular localizations of the cytosolic and chloroplastic isoenzymes (cAPX1 and sAPX, respectively) were verified in vivo by transient expression of fluorescent fusion proteins (Fig. 9 9 ). The differential interference contrast image showed that fluorescence of the GFP-cAPX1 fusion protein was distributed in the cytoplasm around the cell periphery (Figs. 9a–9c 9a–9c ). Fluorescence of the GFP-sAPX fusion protein was detected in spherical spots distributed throughout the cytoplasm, and the spherical chloroplasts were discernible on the basis of the red autofluorescence of chlorophyll; the merged image confirmed that the GFP-sAPX fusion protein was specifically localized in chloroplasts (Figs. 9d–9f 9d–9f ). However, because of the magnification limit of the confocal microscope, the stromal location of the GFP-sAPX fusion protein in the chloroplasts could not be resolved. Confocal laser micrographs of tobacco cells expressing GFP-PpcAPX1 (a–c) and GFP-PpsAPX (d–f) fusion proteins. (a) Differential interference contrast image; (b, e) GFP fluorescence; (c) Merged image of (a) and (b); (d) Chlorophyll autofluorescence; (f) Merged image of (d) and (e); (g) Schematic representation of the T-DNA construction Effect of chronic heat stress on PpAPX genes transcription level 2 Given the observed differences in APX activity, expression analysis of PpAPX genes under chronic heat stress was investigated. In CG, expression of PpcAPX1 was more stable than that of the other two cytosolic APX genes. Expression of PpcAPX2 was immediately induced after 1 d of chronic heat stress and was maintained for 5 d, whereas significant induction of PpcAPX3 was delayed until the 3rd day and thereafter was maintained for 3 d. Inductions of both PpcAPX2 and PpcAPX3 were weakened with increasing duration of chronic heat stress (Fig. 10a 10a ). Compared to that of CG, expressions of the three cytosolic PpcAPX genes in WH showed less marked up-regulation during chronic heat stress, and expression of PpcAPX1 was inhibited (Fig. 10b 10b ). The values represent the mean of three experiments±standard error. Asterisks indicate a significant difference between the control (Con) and heat stress treatment (HT) at P < 0.05 Expression of APX isoenzymes localized in peroxisomes and chloroplasts also differed between CG and WH. PppAPX , PpsAPX , and PptAPX showed similar transcription trends in CG during chronic heat stress. The three APX genes were significantly induced at 3 d after heat stress, and thereafter maintained for 3 d ( P < 0.05). Thereafter, induction was weakened (Fig. 10a 10a ). In WH, the PppAPX transcript level was not affected by chronic heat stress. In chloroplasts, up-regulation of PpsAPX by 2.4-fold after 1 d of treatment and by 2.2-fold after 2 d of chronic heat stress was observed, but thereafter transcription was increasingly inhibited with continued chronic heat stress (Fig. 10b 10b ). Discussion 1 Chloroplasts, mitochondria, and peroxisomes are the major ROS generation sites and are easily damaged under stress conditions in plants (Kratsch and Wise, 2000 2000 ; Mittler et al., 2004 2004 ; Yamamoto et al., 2008 2008 ). Apparent ultrastructural changes were observed in mesophyll cells in response to constant short-term heat stress. Deformed chloroplasts, increased abundance of lipid droplets, swollen thylakoids and mitochondrial cristae, and condensed euchromatin were detected (Figs. 1 1 and 2 2 ). The percentage of damaged chloroplasts was 55% in CG and 57% in WH (Table 2 2 ), which indicated that the ultrastructure of mesophyll cells was severely damaged after only 2 d of constant heat stress. Photosynthesis is the primary function of mesophyll cells. The photosynthetic apparatus is easily damaged by major ROS generation during primary photochemical reactions under environmental stresses. In chloroplasts, the D1 protein, which is a component of the PSII reaction center, is damaged by ROS (Yamamoto et al., 2008 2008 ). Therefore, maximum photochemical efficiency of PSII ( F v / F m ) is considered an indicator of plant stress status (Krause and Weis, 1984 1984 ; Havaux, 1993 1993 ). F v / F m was significantly decreased after constant heat stress (Fig. 3 3 ), which indicated that essential functions of the mesophyll cell were inhibited. Changes in mesophyll cell ultrastructure and photosynthetic performance after chronic heat stress differed from those observed in response to constant heat stress. Damage from chronic heat stress on the mesophyll cell ultrastructure was less severe than that induced by constant heat stress in both cultivars (Figs. 4 4 and 5 5 ). Photosynthetic performance also varied with the heat stress regime. Under constant heat stress, F v / F m declined to nearly 0.7, whereas under chronic heat stress it decreased less markedly to 0.82 (Fig. 6 6 ). Previous studies have shown that a decrease in F v / F m is dependent on the stress regime and species. In cotton F v / F m was only affected if the temperature exceeded 40 °C, whereas in wheat F v / F m abruptly decreased at 35 °C (Law and Crafts-Brandner, 1999 1999 ; Crafts-Brandner and Salvucci, 2002 2002 ). In the present study, F v / F m was maintained above 0.82 under chronic heat stress (Fig. 6 6 ), which indicated that chronic heat stress did not severely damage the pear PSII, or the damaged PSII center was able to recover at a suitable night temperature. It was indicated that repair of the D1 protein in CG was superior to that of WH at high temperature and strong light conditions (Ji et al., 2012 2012 ). The repair mechanism is rapid and efficient (Aro et al., 2005 2005 ). However, with increased duration of chronic heat stress, P n significantly decreased in both cultivars (Fig. 6 6 ). After recovery under field conditions, the photosynthetic capacity of heat-stressed trees was partially restored, which indicated that stomatal limitation was the main reason for photosynthetic inhibition under chronic heat stress, because stomatal conductance and intercellular carbon dioxide concentration decreased under chronic heat stress (data not shown). However, P n of control trees unexpectedly decreased after recovery (Fig. 6 6 ), which might be a result of unsuitable field conditions because the experiment was conducted during a hot summer. APX is a key enzyme in the ascorbate-glutathione cycle, which plays a central role in scavenging H 2 O 2 under stress conditions (Shigeoka et al., 2002 2002 ). APX is widely distributed in plants and eukaryotic algae, but the number and distribution of APX isoenyzmes are much more limited in algae than in higher plants (Ishikawa and Shigeoka, 2008 2008 ). APX belongs to a multigenic family that is classified according to subcellular localization, e.g., cytoplasm, chloroplasts, mitochondria, and peroxisomes in higher plants (Mittler and Zilinskas, 1992 1992 ; Jimenez et al., 1997 1997 ; Ishikawa et al., 1998 1998 ; Teixeira et al., 2004 2004 ; 2006 2006 ). Six APX isoenzyme genes were isolated from P. pyrifolia , which were located in the cytoplasm, peroxisomes, and chloroplasts (Fig. 8 8 ). Sequence analysis showed that higher homology existed between the peroxisomal and cytosolic APXs than between chloroplastic and either peroxisomal or cytosolic APXs (Fig. 8 8 ). The peroxisomal APX was similar to the cytosolic APX except that the former contained a transmembrane helix at the C-terminus, which was consistent with the hypothesis that cytosolic and peroxisomal APXs diverged from chloroplastic APX (Teixeira et al., 2004 2004 ; Najami et al., 2008 2008 ). Chloroplastic APX isoenzyme genes are divided into two groups in plants. In the first group, stroma and thylakoid APXs are encoded by alternative splicing of one gene, as in spinach (Ishikawa et al., 1997 1997 ), whereas in the second group there are two individual genes for different isoenzymes (Teixeira et al., 2004 2004 ; Najami et al., 2008 2008 ). The two chloroplastic APX genes in P. pyrifolia belonged to the second group (Fig. 8 8 ). A transit signal was predicted to be present in the N-terminus of stroma APX. Its targeting function was confirmed in vivo (Fig. 9 9 ), but the transit signal in stroma APX also has a dual targeting function in mitochondria (Chew et al., 2003 2003 ); therefore, the roles of the transit peptide in stroma APX need further verification. Numerous studies of ROS-scavenging enzymes have proved that APX activity increases under heat stress (Sato et al., 2001 2001 ; Ma et al., 2008 2008 ; Kim et al., 2010 2010 ). However, the different characteristics of APX isoenzymes (Nakano and Asada, 1981 1981 ; Asada, 1992 1992 ) imply that they potentially have specific functions under stress conditions. Cytosolic APX isoenzymes (cAPX) are considered to be sensitive and responsible for adaptation to environmental changes. Induction of cAPX gene under environmental stresses has been intensively studied in Arabidopsis . Normally, only cAPX1 is constitutively expressed (Santos et al., 1996 1996 ) and cAPX2 is significantly induced under stress conditions (Fryer et al., 2003 2003 ; Chang et al., 2004 2004 ). APX2 is thermostable and compensates for APX1 under heat stress (Panchuk et al., 2002 2002 ). In CG, expressions of PpcAPX2 and PpcAPX3 were significantly induced, whereas PpcAPX1 was maintained at a steady level, in response to chronic heat stress (Fig. 10a 10a ). However, the inducible expressions of PpcAPX2 and PpcAPX3 were limited in WH, and the expression of PpcAPX1 was even inhibited under chronic heat stress (Fig. 10b 10b ). The inducible expressions of peroxisomal and chloroplastic APX genes under chronic heat stress seemed to be related to that of cytosolic APX. When the cytoslic APX gene was significantly induced, the expression levels of PppAPX , PpsAPX , and PptAPX were also maintained at a high level in CG (Fig. 10a 10a ), but showed the opposite trend in WH (Fig. 10b 10b ). The interrelationship of APX isoenzymes has been proven in Arabidopsis , in which the H 2 O 2 -scavenging system in chloroplasts totally collapses when cAPX1 is knocked out (Davletova et al., 2005 2005 ). However, despite significant induction of cAPX in response to oxidative stresses, transcript levels of chloroplastic and peroxisomal APX isoenzymes are unchanged, and chloroplastic APX activities even decrease under strong light conditions (Yoshimura et al., 2000 2000 ). This contradictory result can be explained as follows. Specific expression of APX genes is genotype-dependent under environmental stress. For example, in wheat cytosolic APXII and thylakoid APX genes are significantly up-regulated in a drought-tolerant cultivar, and cytosolic APXI and stroma APXII genes are increased in a drought-sensitive cultivar, but APX activity increases only in the drought-tolerant genotype (Sečenji et al., 2009 2009 ), because chloroplastic APX activity is rapidly inactivated especially in the absence of ascorbate (Miyake and Asada, 1996 1996 ). The crystal structure of stromal APX shows a unique loop in the vicinity of the heme that is related to the stability of chloroplastic APX, whereas no specific loop is present in cAPX (Martinez et al., 1994 1994 ; Kitajima et al., 2006 2006 ). A specific structure and complex regulatory mechanism at the transcriptional or post-transcriptional level result in different antioxidant capacities under oxidative stresses. In the present study, the transcript patterns of APX genes in two pear cultivars indicate that CG shows better adaptability to chronic heat stress and that induction of cytosolic APX plays an important role in the thermal adaptability of CG. References K Apel , H Hirt . Reactive oxygen species: metabolism, oxidative stress, and signal transduction . Annu Rev Plant Biol , 2004 . 55 ( 1 ): 373 - 399 . 15377225 DOI: 10.1146/annurev.arplant.55.031903.141701 http://doi.org/10.1146/annurev.arplant.55.031903.141701 . Reactive oxygen species: metabolism, oxidative stress, and signal transduction EM Aro , M Suorsa , A Rokka , Y Allahverdiyeva , V Paakkarinen , A Saleem , N Battchikova , E Rintamäki . Dynamics of photosystem II: a proteomic approach to thylakoid protein complexes . J Exp Bot , 2005 . 56 ( 411 ): 347 - 356 . 15569703 DOI: 10.1093/jxb/eri041 http://doi.org/10.1093/jxb/eri041 . Dynamics of photosystem II: a proteomic approach to thylakoid protein complexes K Asada . Ascorbate peroxidase—a hydrogen peroxide-scavenging enzyme in plants . Physiol Plantarum , 1992 . 85 ( 2 ): 235 - 241 . DOI: 10.1111/j.1399-3054.1992.tb04728.x http://doi.org/10.1111/j.1399-3054.1992.tb04728.x . Ascorbate peroxidase—a hydrogen peroxide-scavenging enzyme in plants K Asada . The water-water cycle in chloroplasts: scavenging of active oxygen and dissipation of excess photons . Annu Rev Plant Physiol Plant Mol Biol , 1999 . 50 ( 1 ): 601 - 639 . 15012221 DOI: 10.1146/annurev.arplant.50.1.601 http://doi.org/10.1146/annurev.arplant.50.1.601 . The water-water cycle in chloroplasts: scavenging of active oxygen and dissipation of excess photons K Asada . Production and scavenging of reactive oxygen species in chloroplasts and their functions . Plant Physiol , 2006 . 141 ( 2 ): 391 - 396 . 16760493 DOI: 10.1104/pp.106.082040 http://doi.org/10.1104/pp.106.082040 . Production and scavenging of reactive oxygen species in chloroplasts and their functions GP Bienert , ALB Møller , KA Kristiansen , A Schulz , IM Møller , JK Schjoerring , TP Jahn . Specific aquaporins facilitate the diffusion of hydrogen peroxide across membranes . J Biol Chem , 2007 . 282 ( 2 ): 1183 - 1192 . 17105724 DOI: 10.1074/jbc.M603761200 http://doi.org/10.1074/jbc.M603761200 . Specific aquaporins facilitate the diffusion of hydrogen peroxide across membranes HJ Bohnert , DE Nelson , RG Jensen . Adaptations to environment stresses . Plant Cell , 1995 . 7 ( 7 ): 1099 - 1111 . 12242400 DOI: 10.2307/3870060 http://doi.org/10.2307/3870060 . Adaptations to environment stresses CCC Chang , L Ball , MJ Fryer , NR Baker , S Karpinski , PM Mullineaux . Induction of ascorbate peroxidase 2 expression in wounded Arabidopsis leaves does not involve known wound-signalling pathways but is associated with changes in photosynthesis . Plant J , 2004 . 38 ( 3 ): 499 - 511 . 15086807 DOI: 10.1111/j.1365-313X.2004.02066.x http://doi.org/10.1111/j.1365-313X.2004.02066.x . Induction of ascorbate peroxidase 2 expression in wounded Arabidopsis leaves does not involve known wound-signalling pathways but is associated with changes in photosynthesis O Chew , J Whelan , AH Millar . Molecular definition of the ascorbate-glutathione cycle in Arabidopsis mitochondria reveals dual targeting of antioxidant defenses in plants . J Biol Chem , 2003 . 278 ( 47 ): 46869 - 46877 . 12954611 DOI: 10.1074/jbc.M307525200 http://doi.org/10.1074/jbc.M307525200 . Molecular definition of the ascorbate-glutathione cycle in Arabidopsis mitochondria reveals dual targeting of antioxidant defenses in plants SJ Crafts-Brandner , ME Salvucci . Sensitivity of photosynthesis in a C4 plant, maize, to heat stress . Plant Physiol , 2002 . 129 ( 4 ): 1773 - 1780 . 12177490 DOI: 10.1104/pp.002170 http://doi.org/10.1104/pp.002170 . Sensitivity of photosynthesis in a C4 plant, maize, to heat stress J Dat , S Vandenabeele , E Vranová , M van Montagu , D Inzé , F van Breusegem . Dual action of the active oxygen species during plant stress responses . Cell Mol Life Sci , 2000 . 57 ( 5 ): 779 - 795 . 10892343 DOI: 10.1007/s000180050041 http://doi.org/10.1007/s000180050041 . Dual action of the active oxygen species during plant stress responses S Davletova , L Rizhsky , H Liang , Z Shengqiang , DJ Oliver , J Coutu , V Shulaev , K Schlauch , R Mittler . Cytosolic ascorbate peroxidase 1 is a central component of the reactive oxygen gene network of Arabidopsis . Plant Cell , 2005 . 17 ( 1 ): 268 - 281 . 15608336 DOI: 10.1105/tpc.104.026971 http://doi.org/10.1105/tpc.104.026971 . Cytosolic ascorbate peroxidase 1 is a central component of the reactive oxygen gene network of Arabidopsis CH Foyer , M Lelandais , KJ Kunert . Photooxidative stress in plants . Physiol Plantarum , 1994 . 92 ( 4 ): 696 - 717 . DOI: 10.1111/j.1399-3054.1994.tb03042.x http://doi.org/10.1111/j.1399-3054.1994.tb03042.x . Photooxidative stress in plants I Fridovich . Oxygen toxicity: a radical explanation . J Exp Biol , 1998 . 201 ( 8 ): 1203 - 1209 . 9510531 . Oxygen toxicity: a radical explanation MJ Fryer , L Ball , K Oxborough , S Karpinski , PM Mullineaux , NR Baker . Control of ascorbate peroxidase 2 expression by hydrogen peroxide and leaf water status during excess light stress reveals a functional organisation of Arabidopsis leaves . Plant J , 2003 . 33 ( 4 ): 691 - 705 . 12609042 DOI: 10.1046/j.1365-313X.2003.01656.x http://doi.org/10.1046/j.1365-313X.2003.01656.x . Control of ascorbate peroxidase 2 expression by hydrogen peroxide and leaf water status during excess light stress reveals a functional organisation of Arabidopsis leaves DM Glenn , E Prado , A Erez , J Mcferson , GJ Puterka . A reflective, processed-kaolin particle film affects fruit temperature, radiation reflection, and solar injury in apple . J Am Soc Hortic Sci , 2002 . 127 ( 2 ): 188 - 193 . . A reflective, processed-kaolin particle film affects fruit temperature, radiation reflection, and solar injury in apple M Havaux . Rapid photosynthetic adaptation to heat stress triggered in potato leaves by moderately elevated temperatures . Plant Cell Environ , 1993 . 16 ( 4 ): 461 - 467 . DOI: 10.1111/j.1365-3040.1993.tb00893.x http://doi.org/10.1111/j.1365-3040.1993.tb00893.x . Rapid photosynthetic adaptation to heat stress triggered in potato leaves by moderately elevated temperatures RL Heath , L Packer . Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation . Arch Biochem Biophys , 1968 . 125 ( 1 ): 189 - 198 . 5655425 DOI: 10.1016/0003-9861(68)90654-1 http://doi.org/10.1016/0003-9861(68)90654-1 . Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation XZ Huang , YT Chen , Y Lei , SH Cai , XM Chen . Causes and control strategies of a large number of early falling leaves of pear in Fujian . Chin Agric Sci Bull , 2010 . 26 ( 2 ): 91 - 95 . (in Chinese) . Causes and control strategies of a large number of early falling leaves of pear in Fujian T Ishikawa , S Shigeoka . Recent advances in ascorbate biosynthesis and the physiological significance of ascorbate peroxidase in photosynthesizing organisms . Biosci Biotechnol Biochem , 2008 . 72 ( 5 ): 1143 - 1154 . 18460785 DOI: 10.1271/bbb.80062 http://doi.org/10.1271/bbb.80062 . Recent advances in ascorbate biosynthesis and the physiological significance of ascorbate peroxidase in photosynthesizing organisms T Ishikawa , K Yoshimura , M Tamoi , T Takeda , S Shigeoka . Alternative mRNA splicing of 3′-terminal exons generates ascorbate peroxidase isoenzymes in spinach ( Spinacia oleracea ) chloroplasts . Biochem J , 1997 . 328 ( Pt 3 ): 795 - 800 . 9396722 . Alternative mRNA splicing of 3′-terminal exons generates ascorbate peroxidase isoenzymes in spinach (Spinacia oleracea) chloroplasts T Ishikawa , K Yoshimura , K Sakai , M Tamoi , T Takeda , S Shigeoka . Molecular characterization and physiological role of a glyoxysome-bound ascorbate peroxidase from spinach . Plant Cell Physiol , 1998 . 39 ( 1 ): 23 - 34 . 9516999 DOI: 10.1093/oxfordjournals.pcp.a029285 http://doi.org/10.1093/oxfordjournals.pcp.a029285 . Molecular characterization and physiological role of a glyoxysome-bound ascorbate peroxidase from spinach WW Ji , CH Qiu , Y Jiao , YP Guo , YW Teng . Effects of high temperature and strong light on photosynthesis, D1 protein, and the Deg1 protease in pear ( Pyrus pyrifolia ) leaves . J Fruit Sci , 2012 . 29 ( 5 ): 794 - 799 . . Effects of high temperature and strong light on photosynthesis, D1 protein, and the Deg1 protease in pear (Pyrus pyrifolia) leaves A Jimenez , JA Hernandez , LA Del Rio , F Sevilla . Evidence for the presence of the ascorbate-glutathione cycle in mitochondria and peroxisomes of pea leaves . Plant Physiol , 1997 . 114 ( 1 ): 275 - 284 . 12223704 DOI: 10.1104/pp.114.1.275 http://doi.org/10.1104/pp.114.1.275 . Evidence for the presence of the ascorbate-glutathione cycle in mitochondria and peroxisomes of pea leaves S Karpinski , H Reynolds , B Karpinska , G Wingsle , G Creissen , P Mullineaux . Systemic signaling and acclimation in response to excess excitation energy in Arabidopsis . Science , 1999 . 284 ( 5414 ): 654 - 657 . 10213690 DOI: 10.1126/science.284.5414.654 http://doi.org/10.1126/science.284.5414.654 . Systemic signaling and acclimation in response to excess excitation energy in Arabidopsis MD Kim , YH Kim , SY Kwon , DJ Yun , SS Kwak , HS Lee . Enhanced tolerance to methyl viologen-induced oxidative stress and high temperature in transgenic potato plants overexpressing the CuZnSOD , APX and NDPK2 genes . Physiol Plant , 2010 . 140 ( 2 ): 153 - 162 . 20553417 DOI: 10.1111/j.1399-3054.2010.01392.x http://doi.org/10.1111/j.1399-3054.2010.01392.x . Enhanced tolerance to methyl viologen-induced oxidative stress and high temperature in transgenic potato plants overexpressing the CuZnSOD, APX and NDPK2 genes S Kitajima , KI Tomizawa , S Shigeoka , A Yokota . An inserted loop region of stromal ascorbate peroxidase is involved in its hydrogen peroxide-mediated inactivation . FEBS J , 2006 . 273 ( 12 ): 2704 - 2710 . 16817898 DOI: 10.1111/j.1742-4658.2006.05286.x http://doi.org/10.1111/j.1742-4658.2006.05286.x . An inserted loop region of stromal ascorbate peroxidase is involved in its hydrogen peroxide-mediated inactivation HA Kratsch , RR Wise . The ultrastructure of chilling stress . Plant Cell Environ , 2000 . 23 ( 4 ): 337 - 350 . DOI: 10.1046/j.1365-3040.2000.00560.x http://doi.org/10.1046/j.1365-3040.2000.00560.x . The ultrastructure of chilling stress G Krause , E Weis . Chlorophyll fluorescence as a tool in plant physiology . Photosynth Res , 1984 . 5 ( 2 ): 139 - 157 . DOI: 10.1007/BF00028527 http://doi.org/10.1007/BF00028527 . Chlorophyll fluorescence as a tool in plant physiology RD Law , SJ Crafts-Brandner . Inhibition and acclimation of photosynthesis to heat stress is closely correlated with activation of ribulose-1,5-bisphosphate carboxylase/oxygenase . Plant Physiol , 1999 . 120 ( 1 ): 173 - 182 . 10318695 DOI: 10.1104/pp.120.1.173 http://doi.org/10.1104/pp.120.1.173 . Inhibition and acclimation of photosynthesis to heat stress is closely correlated with activation of ribulose-1,5-bisphosphate carboxylase/oxygenase PM Li , LL Cheng . The elevated anthocyanin level in the shaded peel of ‘anjou’ pear enhances its tolerance to high temperature under high light . Plant Sci , 2009 . 177 ( 5 ): 418 - 426 . DOI: 10.1016/j.plantsci.2009.07.005 http://doi.org/10.1016/j.plantsci.2009.07.005 . The elevated anthocyanin level in the shaded peel of ‘anjou’ pear enhances its tolerance to high temperature under high light G Liu , W Li , P Zheng , T Xu , L Chen , D Liu , S Hussain , Y Teng . Transcriptomic analysis of ‘suli’ pear ( Pyrus pyrifolia white pear group) buds during the dormancy by RNA-Seq . BMC Genomics , 2012 . 13 ( 1 ): 700 23234335 DOI: 10.1186/1471-2164-13-700 http://doi.org/10.1186/1471-2164-13-700 . Transcriptomic analysis of ‘suli’ pear (Pyrus pyrifolia white pear group) buds during the dormancy by RNA-Seq KJ Livak , TD Schmittgen . Analysis of relative gene expression data using real-time quantitative PCR and the 2 −ΔΔ C T method . Methods , 2001 . 25 ( 4 ): 402 - 408 . 11846609 DOI: 10.1006/meth.2001.1262 http://doi.org/10.1006/meth.2001.1262 . Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method YH Ma , FW Ma , JK Zhang , MJ Li , YH Wang , D Liang . Effects of high temperature on activities and gene expression of enzymes involved in ascorbate-glutathione cycle in apple leaves . Plant Sci , 2008 . 175 ( 6 ): 761 - 766 . DOI: 10.1016/j.plantsci.2008.07.010 http://doi.org/10.1016/j.plantsci.2008.07.010 . Effects of high temperature on activities and gene expression of enzymes involved in ascorbate-glutathione cycle in apple leaves SE Martinez , D Huang , A Szczepaniak , WA Cramer , JL Smith . Crystal structure of chloroplast cytochrome reveals a novel cytochrome fold and unexpected heme ligation . Structure , 1994 . 2 ( 2 ): 95 - 105 . 8081747 DOI: 10.1016/S0969-2126(00)00012-5 http://doi.org/10.1016/S0969-2126(00)00012-5 . Crystal structure of chloroplast cytochrome reveals a novel cytochrome fold and unexpected heme ligation R Mittler . Oxidative stress antioxidantandstress tolerance . Trends Plant Sci , 2002 . 7 ( 9 ): 405 - 410 . 12234732 DOI: 10.1016/S1360-1385(02)02312-9 http://doi.org/10.1016/S1360-1385(02)02312-9 . Oxidative stress antioxidantandstress tolerance R Mittler , BA Zilinskas . Molecular cloning and characterization of a gene encoding pea cytosolic ascorbate peroxidase . J Biol Chem , 1992 . 267 ( 30 ): 21802 - 21807 . 1400489 . Molecular cloning and characterization of a gene encoding pea cytosolic ascorbate peroxidase R Mittler , S Vanderauwera , M Gollery , F van Breusegem . Reactive oxygen gene network of plants . Trends Plant Sci , 2004 . 9 ( 10 ): 490 - 498 . 15465684 DOI: 10.1016/j.tplants.2004.08.009 http://doi.org/10.1016/j.tplants.2004.08.009 . Reactive oxygen gene network of plants C Miyake , K Asada . Inactivation mechanism of ascorbate peroxidase at low concentrations of ascorbate; hydrogen peroxide decomposes compound I of ascorbate peroxidase . Plant Cell Physiol , 1996 . 37 ( 4 ): 423 - 430 . DOI: 10.1093/oxfordjournals.pcp.a028963 http://doi.org/10.1093/oxfordjournals.pcp.a028963 . Inactivation mechanism of ascorbate peroxidase at low concentrations of ascorbate; hydrogen peroxide decomposes compound I of ascorbate peroxidase PM Mullineaux . Spatial dependence for hydrogen peroxide-directed signaling in light-stressed plants . Plant Physiol , 2006 . 141 ( 2 ): 346 - 350 . 16760486 DOI: 10.1104/pp.106.078162 http://doi.org/10.1104/pp.106.078162 . Spatial dependence for hydrogen peroxide-directed signaling in light-stressed plants N Najami , T Janda , W Barriah , G Kayam , M Tal , M Guy , M Volokita . Ascorbate peroxidase gene family in tomato: its identification and characterization . Mol Genet Genomics , 2008 . 279 ( 2 ): 171 - 182 . 18026995 DOI: 10.1007/s00438-007-0305-2 http://doi.org/10.1007/s00438-007-0305-2 . Ascorbate peroxidase gene family in tomato: its identification and characterization Y Nakano , K Asada . Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts . Plant Cell Physiol , 1981 . 22 ( 5 ): 867 - 880 . . Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts S Neill , R Desikan , J Hancock . Hydrogen peroxide signalling . Curr Opin Plant Biol , 2002 . 5 ( 5 ): 388 - 395 . 12183176 DOI: 10.1016/S1369-5266(02)00282-0 http://doi.org/10.1016/S1369-5266(02)00282-0 . Hydrogen peroxide signalling II Panchuk , RA Volkov , F Schöffl . Heat stress- and heat shock transcription factor-dependent expression and activity of ascorbate peroxidase in Arabidopsis . Plant Physiol , 2002 . 129 ( 2 ): 838 - 853 . 12068123 DOI: 10.1104/pp.001362 http://doi.org/10.1104/pp.001362 . Heat stress- and heat shock transcription factor-dependent expression and activity of ascorbate peroxidase in Arabidopsis M Santos , H Gousseau , C Lister , C Foyer , G Creissen , P Mullineaux . Cytosolic ascorbate peroxidase from Arabidopsis thaliana L. is encoded by a small multigene family . Planta , 1996 . 198 ( 1 ): 64 - 69 . 8580771 DOI: 10.1007/BF00197587 http://doi.org/10.1007/BF00197587 . Cytosolic ascorbate peroxidase from Arabidopsis thaliana L. is encoded by a small multigene family Y Sato , T Murakami , H Funatsuki , S Matsuba , H Saruyama , M Tanida . Heat shock-mediated APX gene expression and protection against chilling injury in rice seedlings . J Exp Bot , 2001 . 52 ( 354 ): 145 - 151 . 11181723 DOI: 10.1093/jexbot/52.354.145 http://doi.org/10.1093/jexbot/52.354.145 . Heat shock-mediated APX gene expression and protection against chilling injury in rice seedlings M Sečenji , E Hideg , A Bebes , J Györgyey . Transcriptional differences in gene families of the ascorbate-glutathione cycle in wheat during mild water deficit . Plant Cell Rep , 2009 . 29 ( 1 ): 37 - 50 . 19902215 DOI: 10.1007/s00299-009-0796-x http://doi.org/10.1007/s00299-009-0796-x . Transcriptional differences in gene families of the ascorbate-glutathione cycle in wheat during mild water deficit S Shigeoka , T Ishikawa , M Tamoi , Y Miyagawa , T Takeda , Y Yabuta , K Yoshimura . Regulation and function of ascorbate peroxidase isoenzymes . J Exp Bot , 2002 . 53 ( 372 ): 1305 - 1319 . 11997377 DOI: 10.1093/jexbot/53.372.1305 http://doi.org/10.1093/jexbot/53.372.1305 . Regulation and function of ascorbate peroxidase isoenzymes IA Sparkes , J Runions , A Kearns , C Hawes . Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants . Nat Protoc , 2006 . 1 ( 4 ): 2019 - 2025 . 17487191 DOI: 10.1038/nprot.2006.286 http://doi.org/10.1038/nprot.2006.286 . Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants F Teixeira , L Menezes-Benavente , R Margis , M Margis-Pinheiro . Analysis of the molecular evolutionary history of the ascorbate peroxidase gene family: inferences from the rice genome . J Mol Evol , 2004 . 59 ( 6 ): 761 - 770 . 15599508 DOI: 10.1007/s00239-004-2666-z http://doi.org/10.1007/s00239-004-2666-z . Analysis of the molecular evolutionary history of the ascorbate peroxidase gene family: inferences from the rice genome F Teixeira , L Menezes-Benavente , V Galvão , R Margis , M Margis-Pinheiro . Rice ascorbate peroxidase gene family encodes functionally diverse isoforms localized in different subcellular compartments . Planta , 2006 . 224 ( 2 ): 300 - 314 . 16397796 DOI: 10.1007/s00425-005-0214-8 http://doi.org/10.1007/s00425-005-0214-8 . Rice ascorbate peroxidase gene family encodes functionally diverse isoforms localized in different subcellular compartments S Vandenabeele , K van der Kelen , J Dat , I Gadjev , T Boonefaes , S Morsa , P Rottiers , L Slooten , M van Montagu , M Zabeau , 等 . A comprehensive analysis of hydrogen peroxide-induced gene expression in tobacco . PNAS , 2003 . 100 ( 26 ): 16113 - 16118 . 14671332 DOI: 10.1073/pnas.2136610100 http://doi.org/10.1073/pnas.2136610100 . A comprehensive analysis of hydrogen peroxide-induced gene expression in tobacco S Vanderauwera , N Suzuki , G Miller , B van de Cotte , S Morsa , JL Ravanat , A Hegie , C Triantaphylidès , V Shulaev , MCE van Montagu , 等 . Extranuclear protection of chromosomal DNA from oxidative stress . PNAS , 2011 . 108 ( 4 ): 1711 - 1716 . 21220338 DOI: 10.1073/pnas.1018359108 http://doi.org/10.1073/pnas.1018359108 . Extranuclear protection of chromosomal DNA from oxidative stress R Volkov , I Panchuk , P Mullineaux , F Schoffl . Heat stress-induced H 2 O 2 is required for effective expression of heat shock genes in Arabidopsis . Plant Mol Biol , 2006 . 61 ( 4-5 ): 733 - 746 . 16897488 DOI: 10.1007/s11103-006-0045-4 http://doi.org/10.1007/s11103-006-0045-4 . Heat stress-induced H2O2 is required for effective expression of heat shock genes in Arabidopsis J Wang , Y Ou , Z Wu , LZ Dai , SW Liu . Effects of high temperature stress on physiological indicators, early defoliation of early-maturing pear . Southwest China J Agric Sci , 2011 . 24 ( 2 ): 546 - 551 . (in Chinese) . Effects of high temperature stress on physiological indicators, early defoliation of early-maturing pear Y Yamamoto , R Aminaka , M Yoshioka , M Khatoon , K Komayama , D Takenaka , A Yamashita , N Nijo , K Inagawa , N Morita , 等 . Quality control of photosystem II: impact of light and heat stresses . Photosynth Res , 2008 . 98 ( 1-3 ): 589 - 608 . 18937045 DOI: 10.1007/s11120-008-9372-4 http://doi.org/10.1007/s11120-008-9372-4 . Quality control of photosystem II: impact of light and heat stresses K Yoshimura , Y Yabuta , T Ishikawa , S Shigeoka . Expression of spinach ascorbate peroxidase isoenzymes in response to oxidative stresses . Plant Physiol , 2000 . 123 ( 1 ): 223 - 234 . 10806239 DOI: 10.1104/pp.123.1.223 http://doi.org/10.1104/pp.123.1.223 . Expression of spinach ascorbate peroxidase isoenzymes in response to oxidative stresses B Yu , D Zhang , C Huang , M Qian , X Zheng , Y Teng , J Su , Q Shu . Isolation of anthocyanin biosynthetic genes in red Chinese sand pear ( Pyrus pyrifolia Nakai) and their expression as affected by organ/tissue, cultivar, bagging and fruit side . Sci Hort , 2012 . 136 29 - 37 . DOI: 10.1016/j.scienta.2011.12.026 http://doi.org/10.1016/j.scienta.2011.12.026 . Isolation of anthocyanin biosynthetic genes in red Chinese sand pear (Pyrus pyrifolia Nakai) and their expression as affected by organ/tissue, cultivar, bagging and fruit side We thank Prof. Xue-ping ZHOU, Institute of Biotechnology, Zhejiang University, China, for kindly providing the pCHF3-GFP plastid. Compliance with ethics guidelines Dong-feng LIU, Dong ZHANG, Guo-qin LIU, Sayed HUSSAIN, and Yuan-wen TENG declare that they have no conflict of interest. This article does not contain any studies with human or animal subjects performed by any of the authors. 10.1631/jzus.B1300094 Project (No. nycytx-29) supported by the Earmarked Fund for the Modern Agro-industry Technology Research System, China 2013-03-27 2013-11-05 2013-07-01 2022-01-05 Copyright © Zhejiang University and Springer-Verlag Berlin Heidelberg 2013 2013 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 12 14