Menstrual blood-derived mesenchymal stem cells differentiate into functional hepatocyte-like cells

Menstrual blood-derived mesenchymal stem cells differentiate into functional hepatocyte-like cells 1 2 first-author 1 3 2 4 1 1 1 5 5 corresp ‡Corresponding Authors ‡Corresponding Authors †E-mail:majm117@sina.comcxiang@zju.edu.cn †E-mail:majm117@sina.comcxiang@zju.edu.cn majm117@sina.com 1 2 6 corresp ‡Corresponding Authors ‡Corresponding Authors †E-mail:majm117@sina.comcxiang@zju.edu.cn †E-mail:majm117@sina.comcxiang@zju.edu.cn majm117@sina.com State Key Laboratory for Diagnosis and Treatment of Infectious Diseases, the First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310003, China State Key Laboratory for Diagnosis and Treatment of Infectious Diseases, the First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310003, China Institute for Cell-Based Drug Development of Zhejiang Province, Hangzhou 310058, China Institute for Cell-Based Drug Development of Zhejiang Province, Hangzhou 310058, China People’s Hospital of Tongling, Tongling 244000, China People’s Hospital of Tongling, Tongling 244000, China S-Evans Biosciences, Hangzhou 311121, China S-Evans Biosciences, Hangzhou 311121, China The 117th Hospital of PLA, Hangzhou 310013, China The 117th Hospital of PLA, Hangzhou 310013, China Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Hangzhou 310003, China Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Hangzhou 310003, China Orthotopic liver transplantation (OLT) is the only proven effective treatment for both end-stage and metabolic liver diseases. Hepatocyte transplantation is a promising alternative for OLT, but the lack of available donor livers has hampered its clinical application. Hepatocyte-like cells (HLCs) differentiated from many multi-potential stem cells can help repair damaged liver tissue. Yet almost suitable cells currently identified for human use are difficult to harvest and involve invasive procedures. Recently, a novel mesenchymal stem cell derived from human menstrual blood (MenSC) has been discovered and obtained easily and repeatedly. In this study, we examined whether the MenSCs are able to differentiate into functional HLCs in vitro. After three weeks of incubation in hepatogenic differentiation medium containing hepatocyte growth factor (HGF), fibroblast growth factor-4 (FGF-4), and oncostain M (OSM), cuboidal HLCs were observed, and cells also expressed hepatocyte-specific marker genes including albumin (ALB), α-fetoprotein (AFP), cytokeratin 18/19 (CK18/19), and cytochrome P450 1A1/3A4 (CYP1A1/3A4). Differentiated cells further demonstrated in vitro mature hepatocyte functions such as urea synthesis, glycogen storage, and indocyanine green (ICG) uptake. After intrasplenic transplantation into mice with 2/3 partial hepatectomy, the MenSC-derived HLCs were detected in recipient livers and expressed human ALB protein. We also showed that MenSC-derived HLC transplantation could restore the serum ALB level and significantly suppressed transaminase activity of liver injury animals. In conclusion, MenSCs may serve as an ideal, easily accessible source of material for tissue engineering and cell therapy of liver tissues. Menstrual blood-derived mesenchymal stem cell (MenSC) Differentiation Hepatocyte Intrasplenic transplantation Partial hepatectomy Introduction 1 Orthotopic liver transplantation (OLT) represents the only reliable treatment for acute liver failure (ALF), liver failure associated with end-stage chronic liver diseases (CLDs) and non-metastatic liver cancer (Peleman et al., 1987 1987 ). However, the shortage of suitable donor organs, high cost, and the requirement for immunosuppression largely restrict its application. Hepatocyte transplantation is a promising alternative for OLT in the treatment of both end-stage and metabolic liver diseases, because it is less invasive than the whole organ transplantation and can be performed repeatedly (Fox and Chowdhury, 2004 2004 ). Recently, hepatocyte transplantation has been reported to improve metabolic abnormalities present in the animal models of Wilson’s disease, Crigler-Nijjar syndrome type I, and hereditary tyrosinaemia type 1 and lowered serum cholesterol levels in a rabbit model of homozygous familial hyper-cholesterolemia (Overturf et al., 1996 1996 ; Gunsalus et al., 1997 1997 ; Park et al., 2006 2006 ). Furthermore, promising results have been also demonstrated from hepatocyte transplantation in human diseases including glycogen storage disease type 1a, Crigler-Najjar syndrome type I, argininosuccinate lyase deficiency, and inherited factor VII deficiency (Fox et al., 1998 1998 ; Muraca et al., 2002 2002 ; Dhawan et al., 2004 2004 ; Stephenne et al., 2006 2006 ). However, only less than 100 hepatocyte transplantation cases have been reported in humans up to date. The major reasons for this discrepancy are the success of OLT and shortage of available human hepatocytes. Therefore, it is critical to find easily available cell sources equivalent to primary hepatocytes for hepatocyte-like cell (HLC) transplantation. Stem cells have been a focus of regenerative medicine for their multi-potential differentiation ability. It is attractive to develop stem-cell-based therapy or transplanting hepatocytes generated in vitro from stem cells for treatment of liver diseases. Many types of stem cells from different sources have been investigated for hepatic differentiation ability (Yamamoto et al., 2003 2003 ; Banas et al., 2007 2007 ; Chen et al., 2012 2012 ). In addition, the in vivo transplantation of stem cell-derived HLCs improved liver functions of animal models undergoing liver damage (Yamamoto et al., 2003 2003 ; Chen et al., 2012 2012 ). Embryonic stem cells have enormous differentiation ability, but many limitations including teratoma formation after transplantation, immunogenicity and ethical issues are arresting their clinical application (Lin et al., 2011 2011 ). Adult human stem cells are considered as promising candidates for cell therapy, overcoming ethical concerns and risks of rejection. Mesenchymal stem cells (MSCs) obtained from human bone marrow (BM), adipose tissue (AT), placenta, and umbilical cord blood (UCB) have been reported to differentiate in vitro into a variety of lineages, such as osteoblasts, adipocytes, chondrocytes, myoblasts and cardiomyocytes, neural cells, depending on the microenvironment in which they reside (Pittenger et al., 1999 1999 ). Although MSCs from BW, UCB, and AT have been induced into a hepatic lineage, the question of whether these cells are the best sources for liver regeneration remains (Bieback et al., 2004 2004 ; Banas et al., 2007 2007 ; Chen et al., 2012 2012 ). Previous studies suggested that endometrium contains an MSC-like population (Schwab and Gargett, 2007 2007 ). Menstrual blood-derived mesenchymal stem cells (MenSCs) possess stem cell-like characteristics, such as self-renewal, high proliferative potential, and a pluripotent differentiation ability in vitro (Meng et al., 2007 2007 ). MenSCs have been widely used in regenerative medicine research. Recent studies have shown that MenSCs are able to differentiate into cardiocytes with the functions of beating spontaneously after induction and decreasing the myocardial infarction area in a rat model (Hida et al., 2008 2008 ; Ikegami et al., 2010 2010 ). MenSCs transferred dystrophin into dystrophied myocytes through cell fusion and transdifferentiation in vitro and in vivo (Cui et al., 2007 2007 ; Toyoda et al., 2007 2007 ). Furthermore, stem cells isolated from endometrium have been proven to be an excellent cell source for treating experimental disease models, such as critical limb ischemia, stroke, type I diabetes mellitus, Parkinson’s disease, and other neurodegenerative disorders (Murphy et al., 2008 2008 ; Borlongan et al., 2010 2010 ; Li H.Y. et al., 2010 2010 ; Sanberg et al., 2011 2011 ; Santamaria et al., 2011 2011 ). These results indicated that MenSCs could be served as “seeder cells” regenerative medicine including treatment of liver diseases. We hypothesized that MSCs obtained from menstrual blood are able to differentiate into functional HLCs in vitro which can restore liver functions for liver injured animals. Materials and methods 1 Ethics statement 2 This project was approved by the Ethics Committee of the First Affiliated Hospital, School of Medicine, Zhejiang University, China. Written informed consent was provided by donors. All the animal experiments were performed under the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals. All animal experiments were in accordance with legal regulations, including approval by the Animal Care and Use Committee of Zhejiang University, China. Menstrual blood-derived stem cells isolation and culture 2 Human MenSCs were isolated from the menstrual blood of normal donors using a Divacup (S-Evans Biosciences, China) during the first day of menstruation as previously described by Meng et al. ( 2007 2007 ). Briefly, mononuclear cells were separated by Ficoll-Paque (1.077 g/ml; Fisher Scientific, NH) density-gradient centrifugation according to the manufacturer’s instructions. The purified mononuclear cells were allowed to attach in the endometrial/menstrual stem cell culture medium (S-Evans Biosciences, China) overnight at 37 °C in 5% CO 2 . On Day 3, non-adherent cells were removed by washing with phosphate-buffered saline (PBS) while adherent cells were cultured until they reached 80%–90% confluence. Cells were trypsinized, subcultured, and used for experiments during passages 4 to 7. Flow cytometry analysis 2 Surface marker expression levels of cultured MenSCs were analyzed using a flowcytometer (FC500MCL, Beckman Coulter, Fullerton, CA). The 2nd passage of MenSCs (1×10 5 cells) was incubated with direct phycoerythrin (PE)-conjugated monoclonal antibodies against CD29, CD34, CD45, CD73, CD90, CD105, and human leukocyte antigen (HLA)-DR (all purchased from eBioscience, San Diego, CA) for 1 h in the dark at 4 °C, followed by washing and resuspension in PBS. Immunoglobulin isotype (eBioscience, San Diego, CA) incubation was performed as a negative control. Data were analyzed using FlowJo Version 6.1 (Treestar, Ashland, OR). Multi-lineage differentiation assays 2 To induce osteogenic differentiation, MenSCs were cultured in a commercially available osteogenesis differentiation medium (GIBCO, CA). On Day 21, calcium deposits were visualized by alizarin red S stain analysis. To induce adipogenic differentiation, MenSCs were cultured in a commercially available adipogenesis differentiation medium (GIBCO, CA). On Day 14, cells were stained with oil red O. To induce chondrogenic differentiation, MenSCs were cultured in a commercial available chondrogenesis differentiation medium (GIBCO, CA). Chondrogenesis was assessed by alcian blue stain analysis. Hepatogenic differentiation 2 To induce hepatogenic differentiation, the 4th to 7th passages of MenSCs at 1.5×10 5 /cm 2 were cultured in a hepatogenesis differentiation medium for three weeks with medium changes twice weekly. Hepatogenesis differentiation medium consists of Iscove’s Modified Dulbecco’s Medium (IMDM; GIBCO, CA) supplemented with 20 ng/ml hepatocyte growth factor (HGF), 10 ng/ml fibroblast growth factor-4 (FGF-4), 10 ng/ml oncostain M (OSM) (Peprotech, UK), 40 μg/L dexamethasone (DEX; Sigma-Aldrich, MO), and 1× ITS+ Premix (BD Biosciences, CA). Hepatogenic differentiation was identified by cell morphology, reverse transcription polymerase chain reaction (RT-PCR) analysis, and in vitro biochemical functions. All were performed together with undifferentiated MenSCs. Total RNA isolation and RT-PCR 2 RNA was isolated from MenSCs, differentiating cells, or differentiated cells using Trizol reagent (Invitrogen, CA) according to the manufacturer’s instruction. Total RNA (1.0 μg) was reverse transcribed to complementary DNA (cDNA) using the SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA). cDNA was amplified using a Gene Amp PCR 9600 (PerkinElmer, Norwalk, CT) at 95 °C for 45 s, 56 °C for 60 s, and 72 °C for 45 s for 30 cycles, after initial denaturation at 95 °C for 3 min. Primers used are listed in Table 1 1 . ALB: albumin; AFP: α-fetoprotein; CK18/19: cytokeratin 18/19; CYP1A1/3A4: cytochrome P450 1A1/3A4 Gene Forward primer (5′→3′) Reverse primer (5′→3′) Size (bp)   ALB AAGGCAAGTCAGCAGGCATCTCATC TGCTTGAATGTGCTGATGACAGGG 163   AFP GAGATGTGCTGGATTGTC GATACATAAGTGTCCGATAA 644   CK18 GAACCACGAAGAGGAAGTAAA CATCTGTAGGGCGTAGCG 361   CK19 GCGACTACAGCCACTACTACACGA TTCCTTCCCATCCCTCTACCC 897   CYP1A1 AACATCGTCTTGGACCTCTTT GCAATGGTCTCACCGATACAC 464   CYP3A4 CCACCCACCTATGATACTGT ATCCCTTGACTCAACCTTTA 462   β-Actin TCACCACCACGGCCGAGCG TCTCCTTCTGCATCCTGTCG 350 Immunocytochemistry 2 Cells were fixed with 4% paraformaldehyde for 10 min, and permeablized in 0.1% Triton X-100 (Sigma-Aldrich, MO) for 10 min. After blocking in 5% bovine serum albumin (BSA) solution, slides or dishes were incubated with primary antibodies against albumin (ALB), α-fetoprotein (AFP; Dako, Glostrup, Denmark), or human fumarylacetoacetate hydrolase (Fah; AbboMax, CA) at 4 °C overnight. Biotinylated secondary antibody was added and chromogenic reaction visualized using a DAB Horseradish Peroxidase Color Development Kit (Beyotime, China). Cells were counterstained with hematoxylin and examined using a phase contrast microscope. Urea assay 2 The urea concentrations in the supernatants of the induction medium were measured using the Quantichrom Urea Assay Kit (Bioassay Systems, Brussels, Belgium) according to the manufacturer’s instruction. Fresh culture medium supplemented with 6 mmol/L NH 4 Cl was used as negative control. Periodic acid-schiff (PAS) staining for glycogen 2 Differentiated cells were fixed with 4% formaldehyde for 10 min, and permeabilized with 0.1% Triton X-100 for 10 min. The samples were then oxidized in 1% periodic acid for 5 min, rinsed three times in de-ionized H 2 O (dH 2 O), treated with Schiff’s reagent (Sigma-Aldrich, MO) for 20 min in the dark, and rinsed in dH 2 O for 5 min. Finally, they were visualized under a light microscope. Indocyanine green (ICG) uptake assay 2 Hepatogenesis differentiation medium was replaced with IMDM medium containing 1 mg/ml ICG (Aladdin, Shanghai, China). After incubation at 37 °C for 15 min, cells were rinsed three times with PBS and ICG uptake was measured using an inverted microscope. Dishes were refilled with endometrial/menstrual stem cell culture medium for 6 h and color changes were examined again. Construction of liver injury mouse model with 2/3 partial hepatectomy (PH) and hepatocyte-like cell (HLC) transplantation 2 All animals were kept at 23–25 °C with a 12-h light/dark cycle and allowed standard chow and water until the time of the study. An acute liver injury mouse model with 2/3 PH was constructed as previously described (Mitchell and Willenbring, 2008 2008 ). Twenty-five 3–4 weeks old male BALB/c mice were divided into the transplantation group (PH+HLC, 10 mice), the only PH group (PH, 10 mice), and the sham surgery group (Sham, 5 mice). MenSC-derived HLCs were trypsined into aliquots of 1.5×10 6 cells in 150 μl PBS for each animal and stored on ice until transplantation. HLCs were intrasplenically transplanted using a sterile syringe and needle immediately after PH. On Day 14, serum samples were collected and liver functional indicators such as ALB, alanine transaminase (ALT), and aspartate aminotransferase (AST) of the three groups were analyzed by an automatic biochemical analyzer (SHIMADZU, Japan). The livers were excised and fixed with 10% formaldehyde and embedded in paraffin for further study. Statistical analysis 2 Data are expressed as mean±standard deviation (SD). The difference between groups was determined using Student’s t -test. P < 0.05 was considered statistically significant. Results 1 Isolation and characterization of MenSCs 2 Fig. 1a 1a shows that isolated cells from menstrual blood had a typical spindle shape, consistent with the morphology reported by others (Cui et al., 2007 2007 ; Meng et al., 2007 2007 ; Toyoda et al., 2007 2007 ; Allickson and Xiang, 2012 2012 ). The doubling time of the cultured cells was approximate 24 h. Clusters formed in the course of primary culturing and vortex-like cells appeared at 90% confluence in subcultures. These menstrual blood-derived cells were positive for MSC markers including CD29, CD73, CD90, and CD105 but were negative for hematopoietic stem cell markers such as CD34 and CD45, as well as the immune activation marker HLA-DR (Fig. 1b 1b ). Under the osteogenic, adipogenic, or chondrogenic condition, MenSCs could differentiate into osteocytes, adipocytes, or chondrocytes in vitro, respectively (Fig. 1c 1c ). These results indicated that the cells used in this study exhibited the classic MSC phenotype and multi-potential stem cell characteristics. (a) Morphology of human MenSCs harvested from menstrual blood samples of healthy donors. MenSCs started to adhere and after about 5 d started to form colonies (i). MenSCs were subcultured and passaged twice a week and showed a fibroblast-like cell morphology at higher confluence (ii). (b) Flow cytometry analysis for expressions of mesenchymal, hematopoietic and immunologic markers: MenSCs showed strong positive expressions of mesenchymal markers (CD29, CD73, CD90, and CD105), but were negative for the hematopoietic lineage markers (CD34 and CD45) and MHC class II antigen (HLA-DR). (c) MenSCs are induced to differentiate into osteoblasts and stained positive for alizarin red S (left); under adipogenic condition, MenSCs accumulate neutral lipid vacuoles, which are positive for oil red O assay (middle); under chondrogenic condition, MenSCs differentiate into chrondrocyte-like cells and stained positive for alcian blue (right). Scale bar 50 μm In vitro hepatogenic differentiation of MenSCs 2 To examine the hepatogenic differentiation ability in vitro, MenSCs were cultured in a specific hepatogenesis differentiation medium containing HGF, FGF-4, and OSM. Cell morphology was monitored every 2–3 d using a phase-contrast microscope. During the differentiation procedure, cells gradually changed from spindle, bipolar, fibroblast-like cells to round or polygonal epithelioid cells (Fig. 2a 2a ). On Day 21, almost all induced cells showed epithelioid and cuboidal shapes, similar to primary human hepatocytes. Cells cultured in a medium without conditioned factors were set as control and showed no HLC morphology. (a) Sequential morphological changes from MenSCs to hepatocyte-like cells. Cells gradually changed from spindle, bipolar, fibroblast-like cells to round or polygonal epithelioid cells. (b) RT-PCR gene expressions of MenSCs and MenSC-derived hepatocyte-like cells for the hepatocyte markers albumin (ALB), α-fetoprotein (AFP), cytokeratin 18 (CK-18), CK-19, cytochrome P450 1A1 (CYP1A1), and CYP3A4. RNA was isolated from undifferentiated MenSCs and from MenSCs during hepatogenic induction on Days 10 and 20. HepG2 cells were used as positive control which constantly expresses hepatocyte-specific markers at the mRNA level. Gene expressions were normalized to β-actin. (c) Immunocytochemical staining analysis of hepatocyte-specific markers: on Day 21, cells were fixed and stained with monoclonal antibodies against ALB, AFP, and Fah. These hepatocyte-specific markers were positive in MenSC-derived HLCs but negative in undifferentiated MenSCs. Scale bar 50 μm Cells on Days 10 and 20 post-induction were harvested for gene expression analysis. Hepatocyte-specific marker genes including ALB , AFP , CK18 , CK19 , CYP1A1 , and CYP3A4 (Table 1 1 ) were evaluated by RT-PCR analysis. ALB , CK19 , and CYP3A4 were expressed after 10 d of induction, and AFP was expressed after an additional 10 d (Fig. 2b 2b ). Undifferentiated cells showed no hepatocyte-specific gene expression except for CK18 and CYP1A1 , which is consistent with previous studies (Lee et al., 2004 2004 ; Chen et al., 2012 2012 ). In the next experiments, we tested whether MenSCs expressed hepatocyte-specific proteins after hepatogenic differentiation. Fig. 2c 2c shows the MenSC-derived HLCs were positively stained for hepatocyte-specific markers such as ALB, AFP, and Fah. Undifferentiated cells were not stained positively for all these three markers. Functional characterization of the MenSC-derived HLCs 2 To assess the functional status of the human MenSCs-derived HLCs, we firstly examined their metabolic capacity-related protein cytochrome P450 (CYP450) enzyme expression using the immunocytochemistry method. As shown in Fig. 3a 3a (Page 969), the MenSC-derived HLCs were positively stained for both of the most important enzyme isoforms, CYP3A4 and CYP1A1. Our results indicated that the differentiated cells expressed CYP450 enzyme and might have biological activity similar to primary human hepatocytes. (a) On Day 21, the differentiated HLCs were fixed and stained with monoclonal antibodies against CYP1A1/3A4. Immunocytochemical analysis results indicated that differentiated HLCs express functional hepatocyte-specific enzymes which are not expressed by undifferentiated cells. (b) PAS staining for glycogen showed that differentiated cell could store glycogen after hepatogenic induction for 21 d. Undifferentiated cells stained negative for glycogen storage. (c) Differentiated MenSCs were positive for ICG after incubation in ICG solution for 15 min. ICG in the differentiated cells was partly released 6 h after replacement ICG solution with hepatogenic induction medium. (d) Differentiated cells produced urea in a time-dependent manner. Data are expressed as mean±SD. Scale bar 50 μm To further characterize the glycogen storage function of MenSC-derived HLCs, the presence of stored glycogen was determined using the PAS staining method. After hepatogenic induction for 3 weeks, glycogen was stained magenta and could be found in the differentiated cells, while no positive staining was observed in the undifferentiated cells (Fig. 3b 3b ). The ICG uptake assay, which also indicates the mature hepatocytes, was also used to examine the in vitro generated HLCs. As shown in Fig. 3c 3c , most differentiated cells were positive for ICG after 15 min incubation (left panel). Six hours after refilling plates with endometrial/menstrual stem cell culture medium, ICG taken up by the differentiated cells was partially released (right panel). Undifferentiated cells were used as a negative control and showed no ICG uptake and release abilities (data not shown). Secretion of urea by the differentiated cells was monitored on Days 0, 3, 6, 9, 12, 15, 18, 21, and 24. Urea production was detectable on Day 3 and increased gradually during the hepatogenic differentiation (Fig. 3d 3d ). Transplantation of MenSC-derived HLCs into mice with 2/3 PH 2 To assess the therapeutic potential of our generated HLCs derived from MenSCs, an acute liver injury mouse model with 2/3 PH was used. We transplanted 1.5×10 6 MenSC-derived HLCs directly into the splenic pulp of PH mice. We firstly examined whether the transplanted cells were engrafted into liver parenchyma of the recipients. Antibodies against human-specific mitochondria and albumin were used to detect human liver cells in mouse liver. Recipient mice that received intrasplenic transplantation of MenSC-derived HLCs were sacrificed 8 weeks after transplantation. The immunohistochemical staining demonstrated the presence of human mitochondria and albumin in the liver parenchyma of the recipient animals (Fig. 4a 4a ; Page 969). To further assess the effect of MenSC-derived HLC transplantation on the liver function of PH mice, serum levels of ALB, ALT, and AST were evaluated. As shown in Fig. 4b 4b , the ALB levels of the PH+HLC group were higher than that of the only PH group, while the ALT and AST levels of the PH+HLC group were significantly lower than those of the only PH group. Although the liver function of the PH+HLC group was worse than that of the Sham group, our results indicated that MenSC-derived HLC transplantation could significantly improve liver function after traumatic liver injury. (a) MenSC-derived HLCs were transplanted into BALB/c mice with 2/3 PH and integrated into the liver parenchyma. Serial liver sections were stained for both human-specific mitochondria and ALB immunostaining. Human liver sections were used as positive control (i and iii) while mouse liver sections were used as negative control (ii and iv). (b) Serum levels of albumin (ALB), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) in PH+HLC mice ( n =10), only PH group mice ( n =10), and sham surgery group (Sham, n =5). * P < 0.05; ** P < 0.01. Data are expressed as mean±SD. Scale bar 50 μm Discussion 1 Most patients with end-stage liver diseases have no matched liver for transplantation. Hepatocyte transplantation might become more feasible, efficient and safe than whole organ transplantation to treat these patients. However, the shortage of matched primary hepatocytes and the difficulty of maintenance of hepatocyte functions in vitro largely hampered its clinical applications. Generation of functional hepatocytes from stem cells might overcome the limitations that hepatocyte transplantation faced and hold considerable promise for future clinical practices. The hepatogenic potential of stem cells from different sources has been reported previously (Yamamoto et al., 2003 2003 ; Banas et al., 2007 2007 ; Chen et al., 2012 2012 ). Stem cells from an embryo face the hurdles of teratoma formation and the ethical and/or moral issues of the creation, usage and destruction of a human embryo (Lin et al., 2011 2011 ; Allickson and Xiang, 2012 2012 ). Another type of stem cells, named adult or somatic stem cells, has a controlled behavior and holds great promise for cell therapy and regenerative medicine (Allickson et al., 2011 2011 ; Lin et al., 2011 2011 ; Allickson and Xiang, 2012 2012 ). Adult stem cells harvested from BW, AT, and UCB have shown multi-potent capacity and can be induced to differentiate into functional hepatocytes (Banas et al., 2007 2007 ; Chen et al., 2012 2012 ; Yu et al., 2012 2012 ). However, BW- and AT-derived stem cells cannot be easily obtained by practical, cost-effective methods while obtaining UCB stem cells is limited to the time of birth (Patel and Silva, 2008 2008 ). Endometrial tissue is a prolific source of stem cells that reoccur monthly (Allickson et al., 2011 2011 ). Many studies have demonstrated that endometrial stem cells can be harvested from menstrual blood by a non-invasive method (Cui et al., 2007 2007 ; Patel and Silva, 2008 2008 ; Patel et al., 2008 2008 ; Borlongan et al., 2010 2010 ; Phuc et al., 2011 2011 ; Allickson and Xiang, 2012 2012 ). Consistent with previous reports, the MenSCs used in our study expressed classic MSC markers (CD29, CD73, CD90, and CD105) but did not express hematopoietic stem cell markers (CD34 and CD45) and immune activation markers (HLA-DR) (Cui et al., 2007 2007 ; Patel and Silva, 2008 2008 ; Patel et al., 2008 2008 ; Borlongan et al., 2010 2010 ; Phuc et al., 2011 2011 ; Allickson and Xiang, 2012 2012 ). As mentioned by Patel et al. ( 2008 2008 ), the MenSCs are also positive for both Oct-4 and SSEA-4 markers expressed by human embryonic stem cells, which may explain their rapid expansion and multi-potent capability in this study (Patel and Silva, 2008 2008 ; Patel et al., 2008 2008 ). Meng et al. ( 2007 2007 ) have obtained stem cells from menstrual blood and induced the cells to differentiate into 9 different cell lineages. Although positively stained for hepatocyte-specific marker albumin, the generated HLCs in Meng et al. ( 2007 2007 ) were not further validated for their function in vitro and in vivo. In the present study, we tested whether the MenSCs could differentiate into functional hepatocytes in vitro and examined their treatment effect in vivo. Strategies for transdifferentiation of stem cells into hepatocytes include induction by cocktails of cytokines, stimulation by chemicals, co-culture with primary liver cells or conditioned hepatocyte culture medium, and in vivo transplantation (Banas et al., 2007 2007 ). Induction systems using differentiation condition mediums containing cytokines and growth factors have been widely studied (Lee et al., 2004 2004 ; Banas et al., 2007 2007 ; Chen et al., 2012 2012 ). These systems do not require co-culture and avoid undesired cell-cell interactions. HGF, epidermal growth factor (EGF), FGF, and OSM have been shown to possess a potent effect on hepatic growth and differentiation in vitro. However, it is still not clear which of those stem cells would be the best source for hepatocyte generation or which would be the best protocol. BW-MSCs cultured with FGF-4 and HGF on Matrigel can differentiate into cells expressing several liver-specific markers and had functional characteristics of hepatocyte such as albumin and urea secretion and CYP450 activity (Schwartz et al., 2002 2002 ). Other researchers achieved functional hepatocytes derived from BM-MSCs using sequential treatment with factors (Lee et al., 2004 2004 ; Snykers et al., 2006 2006 ; Li J. et al., 2010 2010 ). These cells also had the characteristics of HLCs including albumin and urea secretion, glycogen storage, low-density lipoprotein (LDL) uptake, and CYP activity. As well as hematopoietic stem cells (HSCs), UCB-MSCs contain stem cells with the properties of MSCs. It has been reported that after treatment with HGF, DEX, and OSM, UCB-MSCs differentiate into HLCs (Lee et al., 2004 2004 ). AT-MSCs are an attractive source of MSCs for stem cell-based therapy. The ability of AT-MSCs to differentiate into HLCs was first observed by Seo et al. ( 2005 2005 ). Banas et al. ( 2007 2007 ) reported hepatogenic differentiation of AT-MSCs from CD105 + AT-MSCs. Other MSCs from amniotic fluid and placenta have been also reported to differentiate into functional HLCs (Chien et al., 2006 2006 ; de Coppi et al., 2007 2007 ). In this study, MenSCs were induced to differentiate into heoatocytes with a cocktail of HGF, FGF-4, and OSM (Chen et al., 2007 2007 ; Li J. et al., 2010 2010 ). We demonstrated the ability of MenSCs to undergo hepatogenic differentiation, resulting in the achievement of functional and transplantable hepatocytes with high differentiation efficiency. The differentiated hepatocytes derived from MenSCs not only displayed HLC morphology and expressed hepatic cell markers, but also possessed mature hepatocyte-specific functions. In addition, the MenSC-derived hepatocytes expressed CYP1A1 and CYP3A4 enzymes, which are involved in drug, xenobiotic metabolism, and sterol and bile acid synthesis (Banas et al., 2007 2007 ). Therefore, our findings also suggest that the MenSC-derived hepatocytes might be useful for in vitro preclinical drug investigations. Liver injury is the most common cause of death associated with abdominal trauma (Chen et al., 2012 2012 ). The 2/3 PH represents the most commonly used model for the study of liver regeneration after traumatic liver injury (Mitchell and Willenbring, 2008 2008 ). We transplanted the in vitro generated hepatocytes into liver injury mice with 2/3 PH and observed direct incorporation into the liver, which was confirmed by human mitochondria and albumin immunostaining. Excitingly, the intrasplenic transplantation of MenSC-derived HLCs restored serum albumin level and significantly suppressed transaminase activity of liver injury animals, indicating that these in vitro generated hepatocytes might be useful for treatment of end-stage liver injury. Fah −/− mice defective in tyrosine metabolism require 2-(2-nitro-4-trifluoro-methylbenzyol)-1,3-cyclohexanedione (NTBC) supply for survival. After removing NTBC from the drinking water (NTBC-off), Fah −/− mice undergo liver failure and death (Huang et al., 2011 2011 ). Fah −/− mice undergoing liver failure can be rescued by transplantation of wild-type primary hepatocytes and represent a useful tool to study in vivo repopulation and functions of MenSC-derived hepatocytes. In the present study, MenSC-derived hepatocytes were transplanted directly into the splenic pulp of Fah −/− mice. Three weeks after transplantation, the MenSC-derived hepatocytes were detected in the liver parenchyma by immunofluorescent methods (Fig. 5a 5a ). Incorporated cells were co-stained with 4′,6-diamidino-2-phenylindole (DAPI), indicating the injected cells remained as whole cells within the recipient livers (Fig. 5a 5a , lower panel). Huang et al. ( 2011 2011 ) have reported that the Fah −/− mice without transplantation were dead within 6.5 weeks after NTBC-off. Although we did not get sufficient Fah −/− mice to determine whether MenSC-derived hepatocytes could restore the liver function of recipients, the mice that received hepatocyte transplantation were alive 9 weeks after NTBC-off and showed increased body weight until scarification (data not shown). It has been shown that hepatocytes have the ability to replicate and contribute to the regeneration of the liver (Chen et al., 2012 2012 ). We showed that the transplanted MenSC-derived hepatocytes had a long life span and continuously expressed hepatocyte-specific proteins including ALB and Fah in vivo (Figs. 4a 4a and 5b 5b ), resulting in liver function restoration. Homing of the MenSC-derived hepatocytes to injured liver tissue was showed in this study, but the mechanism of attrition remains unknown. The chemokine stromal cell-derived factor-1 (SDF-1) has been found to be expressed by injured liver tissues and its receptor CXCR4 is expressed by MenSCs (Allickson et al., 2011 2011 ). Whether the SDF-1/CXCR4 pathway or other migration related pathways are involved in the homing of MenSC-derived hepatocyte should be addressed in further studies. (a) MenSC-derived HLCs were labeled with 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (DiI) dye and transplanted into the spleen of Fah −/− mice. Frozen sections were made and DiI-labeled HLCs were detected in the recipient liver 3 weeks after transplantation. Immunofluorescent analysis with monoclonal antibody against human mitochondria also confirmed that transplanted HLCs integrated into the liver parenchyma. (b) Engrafted MenSC-derived HLCs expressed human Fah protein accumulating in nodules and cord in the liver parenchyma at 3 and 9 weeks after transplantation. Human liver sections and mouse liver sections were used as positive and negative controls, respectively. Scale bar 50 μm Tumors were not found in the MenSC-derived hepatocyte transplanted mice in the present study. Allickson et al. ( 2011 2011 ) assessed the safety of cell infusion in Harlan Sprague Dawley mice and Dunkin Hartley Albino guinea pigs. Moreover, MenSCs did not form tumors two months after subcutaneous xenograft in nude mice in our preliminary study (data not shown). These results indicate that hepatocytes differentiated from MenSCs are safe for in vivo transplantation. Another topic of interest requiring consideration is the correlation between factors such as donor age, cancer record, liver function, and the hepatogenic differentiation potential of MenSC from different females. In summary, we have presented in vitro generation of functional and transplantable hepatocytes from MenSCs. We believe that using the MenSC-derived HLCs as a source of hepatocytes could help the development of alternative methods for treating end-stage liver diseases and toxicity screening assays for drug discovery. References J Allickson , C Xiang . Human adult stem cells from menstrual blood and endometrial tissue . J Zhejiang Univ-Sci B (Biomed & Biotechnol) , 2012 . 13 ( 5 ): 419 - 420 . DOI: 10.1631/jzus.B1200062 http://doi.org/10.1631/jzus.B1200062 . Human adult stem cells from menstrual blood and endometrial tissue JG Allickson , A Sanchez , N Yefimenko , CV Borlongan , PR Sanberg . Recent studies assessing the proliferative capability of a novel adult stem cell identified in menstrual blood . Open Stem Cell J , 2011 . 3 ( 2011 ): 4 - 10 . 21686032 DOI: 10.2174/1876893801103010004 http://doi.org/10.2174/1876893801103010004 . Recent studies assessing the proliferative capability of a novel adult stem cell identified in menstrual blood A Banas , T Teratani , Y Yamamoto , M Tokuhara , F Takeshita , G Quinn , H Okochi , T Ochiya . Adipose tissue-derived mesenchymal stem cells as a source of human hepatocytes . Hepatology , 2007 . 46 ( 1 ): 219 - 228 . 17596885 DOI: 10.1002/hep.21704 http://doi.org/10.1002/hep.21704 . Adipose tissue-derived mesenchymal stem cells as a source of human hepatocytes K Bieback , S Kern , H Kluter , H Eichler . Critical parameters for the isolation of mesenchymal stem cells from umbilical cord blood . Stem Cells , 2004 . 22 ( 4 ): 625 - 634 . 15277708 DOI: 10.1634/stemcells.22-4-625 http://doi.org/10.1634/stemcells.22-4-625 . Critical parameters for the isolation of mesenchymal stem cells from umbilical cord blood C Borlongan , VY Kaneko , M Maki , SJ Yu , M Ali , JG Allickson , CD Sanberg , N Kuzmin-Nichols , PR Sanberg . Menstrual blood cells display stem cell-like phenotypic markers and exert neuroprotection following transplantation in experimental stroke . Stem Cells Dev , 2010 . 19 ( 4 ): 439 - 452 . 19860544 DOI: 10.1089/scd.2009.0340 http://doi.org/10.1089/scd.2009.0340 . Menstrual blood cells display stem cell-like phenotypic markers and exert neuroprotection following transplantation in experimental stroke Y Chen , XJ Dong , GR Zhang , JZ Shao , LX Xiang . In vitro differentiation of mouse bone marrow stromal stem cells into hepatocytes induced by conditioned culture medium of hepatocytes . J Cell Biochem , 2007 . 102 ( 1 ): 52 - 63 . 17340623 DOI: 10.1002/jcb.21275 http://doi.org/10.1002/jcb.21275 . In vitro differentiation of mouse bone marrow stromal stem cells into hepatocytes induced by conditioned culture medium of hepatocytes YF Chen , CY Tseng , HW Wang , HC Kuo , VW Yang , OK Lee . Rapid generation of mature hepatocyte-like cells from human induced pluripotent stem cells by an efficient three-step protocol . Hepatology , 2012 . 55 ( 4 ): 1193 - 1203 . 22095466 DOI: 10.1002/hep.24790 http://doi.org/10.1002/hep.24790 . Rapid generation of mature hepatocyte-like cells from human induced pluripotent stem cells by an efficient three-step protocol CC Chien , BL Yen , FK Lee , TH Lai , YC Chen , SH Chan , HI Huang . In vitro differentiation of human placenta-derived multipotent cells into hepatocyte-like cells . Stem Cells , 2006 . 24 ( 7 ): 1759 - 1768 . 16822884 DOI: 10.1634/stemcells.2005-0521 http://doi.org/10.1634/stemcells.2005-0521 . In vitro differentiation of human placenta-derived multipotent cells into hepatocyte-like cells CH Cui , T Uyama , K Miyado , M Terai , S Kyo , T Kiyono , A Umezawa . Menstrual blood-derived cells confer human dystrophin expression in the murine model of Duchenne muscular dystrophy via cell fusion and myogenic transdifferentiation . Mol Biol Cell , 2007 . 18 ( 5 ): 1586 - 1594 . 17314403 DOI: 10.1091/mbc.E06-09-0872 http://doi.org/10.1091/mbc.E06-09-0872 . Menstrual blood-derived cells confer human dystrophin expression in the murine model of Duchenne muscular dystrophy via cell fusion and myogenic transdifferentiation P de Coppi , Jr G Bartsch , MM Siddiqui , T Xu , CC Santos , L Perin , G Mostoslavsky , AC Serre , EY Snyder , JJ Yoo , 等 . Isolation of amniotic stem cell lines with potential for therapy . Nat Biotechnol , 2007 . 25 ( 1 ): 100 - 106 . 17206138 DOI: 10.1038/nbt1274 http://doi.org/10.1038/nbt1274 . Isolation of amniotic stem cell lines with potential for therapy A Dhawan , RR Mitry , RD Hughes , S Lehec , C Terry , S Bansal , R Arya , JJ Wade , A Verma , ND Heaton , 等 . Hepatocyte transplantation for inherited factor VII deficiency . Transplantation , 2004 . 78 ( 12 ): 1812 - 1814 . 15614156 DOI: 10.1097/01.TP.0000146386.77076.47 http://doi.org/10.1097/01.TP.0000146386.77076.47 . Hepatocyte transplantation for inherited factor VII deficiency IJ Fox , JR Chowdhury . Hepatocyte transplantation . J Hepatol , 2004 . 40 ( 6 ): 878 - 886 . 15158325 DOI: 10.1016/j.jhep.2004.04.009 http://doi.org/10.1016/j.jhep.2004.04.009 . Hepatocyte transplantation IJ Fox , JR Chowdhury , SS Kaufman , TC Goertzen , NR Chowdhury , PI Warkentin , K Dorko , BV Sauter , SC Strom . Treatment of the Crigler-Najjar syndrome type I with hepatocyte transplantation . N Engl J Med , 1998 . 338 ( 20 ): 1422 - 1426 . 9580649 DOI: 10.1056/NEJM199805143382004 http://doi.org/10.1056/NEJM199805143382004 . Treatment of the Crigler-Najjar syndrome type I with hepatocyte transplantation JR Gunsalus , DA Brady , SM Coulter , BM Gray , AS Edge . Reduction of serum cholesterol in Watanabe rabbits by xenogeneic hepatocellular transplantation . Nat Med , 1997 . 3 ( 1 ): 48 - 53 . 8986740 DOI: 10.1038/nm0197-48 http://doi.org/10.1038/nm0197-48 . Reduction of serum cholesterol in Watanabe rabbits by xenogeneic hepatocellular transplantation N Hida , N Nishiyama , S Miyoshi , S Kira , K Segawa , T Uyama , T Mori , K Miyado , Y Ikegami , C Cui , 等 . Novel cardiac precursor-like cells from human menstrual blood-derived mesenchymal cells . Stem Cells , 2008 . 26 ( 7 ): 1695 - 1704 . 18420831 DOI: 10.1634/stemcells.2007-0826 http://doi.org/10.1634/stemcells.2007-0826 . Novel cardiac precursor-like cells from human menstrual blood-derived mesenchymal cells P Huang , Z He , S Ji , H Sun , D Xiang , C Liu , Y Hu , X Wang , L Hui . Induction of functional hepatocyte-like cells from mouse fibroblasts by defined factors . Nature , 2011 . 475 ( 7356 ): 386 - 389 . 21562492 DOI: 10.1038/nature10116 http://doi.org/10.1038/nature10116 . Induction of functional hepatocyte-like cells from mouse fibroblasts by defined factors Y Ikegami , S Miyoshi , N Nishiyama , N Hida , K Okamoto , K Miyado , K Segawa , S Ogawa , A Umezawa . Serum-independent cardiomyogenic transdifferentiation in human endometrium-derived mesenchymal cells . Artif Organs , 2010 . 34 ( 4 ): 280 - 288 . 20420609 DOI: 10.1111/j.1525-1594.2009.00859.x http://doi.org/10.1111/j.1525-1594.2009.00859.x . Serum-independent cardiomyogenic transdifferentiation in human endometrium-derived mesenchymal cells KD Lee , TK Kuo , J Whang-Peng , YF Chung , CT Lin , SH Chou , JR Chen , YP Chen , OK Lee . In vitro hepatic differentiation of human mesenchymal stem cells . Hepatology , 2004 . 40 ( 6 ): 1275 - 1284 . 15562440 DOI: 10.1002/hep.20469 http://doi.org/10.1002/hep.20469 . In vitro hepatic differentiation of human mesenchymal stem cells HY Li , YJ Chen , SJ Chen , CL Kao , LM Tseng , WL Lo , CM Chang , DM Yang , HH Ku , NF Twu , 等 . Induction of insulin-producing cells derived from endometrial mesenchymal stem-like cells . J Pharmacol Exp Ther , 2010 . 335 ( 3 ): 817 - 829 . 20855446 DOI: 10.1124/jpet.110.169284 http://doi.org/10.1124/jpet.110.169284 . Induction of insulin-producing cells derived from endometrial mesenchymal stem-like cells J Li , R Tao , W Wu , H Cao , J Xin , J Guo , L Jiang , X Hong , AA Demetriou , D Farkas , 等 . Transcriptional profiling and hepatogenic potential of acute hepatic failure-derived bone marrow mesenchymal stem cells . Differentiation , 2010 . 80 ( 2-3 ): 166 - 174 . 20427118 DOI: 10.1016/j.diff.2010.04.002 http://doi.org/10.1016/j.diff.2010.04.002 . Transcriptional profiling and hepatogenic potential of acute hepatic failure-derived bone marrow mesenchymal stem cells J Lin , D Xiang , JL Zhang , J Allickson , C Xiang . Plasticity of human menstrual blood stem cells derived from the endometrium . J Zhejiang Univ-Sci B (Biomed & Biotechnol) , 2011 . 12 ( 5 ): 372 - 380 . DOI: 10.1631/jzus.B1100015 http://doi.org/10.1631/jzus.B1100015 . Plasticity of human menstrual blood stem cells derived from the endometrium X Meng , TE Ichim , J Zhong , A Rogers , Z Yin , J Jackson , H Wang , W Ge , V Bogin , KW Chan , 等 . Endometrial regenerative cells: a novel stem cell population . J Transl Med , 2007 . 5 57 18005405 DOI: 10.1186/1479-5876-5-57 http://doi.org/10.1186/1479-5876-5-57 . Endometrial regenerative cells: a novel stem cell population C Mitchell , H Willenbring . A reproducible and well-tolerated method for 2/3 partial hepatectomy in mice . Nat Protoc , 2008 . 3 ( 7 ): 1167 - 1170 . 18600221 DOI: 10.1038/nprot.2008.80 http://doi.org/10.1038/nprot.2008.80 . A reproducible and well-tolerated method for 2/3 partial hepatectomy in mice M Muraca , G Gerunda , D Neri , MT Vilei , A Granato , P Feltracco , M Meroni , G Giron , AB Burlina . Hepatocyte transplantation as a treatment for glycogen storage disease type 1a . Lancet , 2002 . 359 ( 9303 ): 317 - 318 . 11830200 DOI: 10.1016/S0140-6736(02)07529-3 http://doi.org/10.1016/S0140-6736(02)07529-3 . Hepatocyte transplantation as a treatment for glycogen storage disease type 1a MP Murphy , H Wang , AN Patel , S Kambhampati , N Angle , K Chan , AM Marleau , A Pyszniak , E Carrier , TE Ichim , 等 . Allogeneic endometrial regenerative cells: an “off the shelf solution” for critical limb ischemia? . J Transl Med , 2008 . 6 ( 1 ): 45 18713449 DOI: 10.1186/1479-5876-6-45 http://doi.org/10.1186/1479-5876-6-45 . Allogeneic endometrial regenerative cells: an “off the shelf solution” for critical limb ischemia? K Overturf , M Al-Dhalimy , R Tanguay , M Brantly , CN Ou , M Finegold , M Grompe . Hepatocytes corrected by gene therapy are selected in vivo in a murine model of hereditary tyrosinaemia type I . Nat Genet , 1996 . 12 ( 3 ): 266 - 273 . 8589717 DOI: 10.1038/ng0396-266 http://doi.org/10.1038/ng0396-266 . Hepatocytes corrected by gene therapy are selected in vivo in a murine model of hereditary tyrosinaemia type I SM Park , K Vo , M Lallier , AS Cloutier , P Brochu , F Alvarez , SR Martin . Hepatocyte transplantation in the Long Evans Cinnamon rat model of Wilson’s disease . Cell Transplant , 2006 . 15 ( 1 ): 13 - 22 . 16700326 DOI: 10.3727/000000006783982188 http://doi.org/10.3727/000000006783982188 . Hepatocyte transplantation in the Long Evans Cinnamon rat model of Wilson’s disease AN Patel , F Silva . Menstrual blood stromal cells: the potential for regenerative medicine . Regen Med , 2008 . 3 ( 4 ): 443 - 444 . 18588464 DOI: 10.2217/17460751.3.4.443 http://doi.org/10.2217/17460751.3.4.443 . Menstrual blood stromal cells: the potential for regenerative medicine AN Patel , E Park , M Kuzman , F Benetti , FJ Silva , JG Allickson . Multipotent menstrual blood stromal stem cells: isolation, characterization, and differentiation . Cell Transplant , 2008 . 17 ( 3 ): 303 - 311 . 18522233 DOI: 10.3727/096368908784153922 http://doi.org/10.3727/096368908784153922 . Multipotent menstrual blood stromal stem cells: isolation, characterization, and differentiation RR Peleman , JS Gavaler , DH van Thiel , C Esquivel , R Gordon , S Iwatsuki , TE Starzl . Orthotopic liver transplantation for acute and subacute hepatic failure in adults . Hepatology , 1987 . 7 ( 3 ): 484 - 489 . 3552924 DOI: 10.1002/hep.1840070312 http://doi.org/10.1002/hep.1840070312 . Orthotopic liver transplantation for acute and subacute hepatic failure in adults PV Phuc , DH Lam , VB Ngoc , DT Thu , NT Nguyet , PK Ngoc . Production of functional dendritic cells from menstrual blood—a new dendritic cell source for immune therapy . In Vitro Cell Dev Biol Anim , 2011 . 47 ( 5-6 ): 368 - 375 . 21424240 DOI: 10.1007/s11626-011-9399-2 http://doi.org/10.1007/s11626-011-9399-2 . Production of functional dendritic cells from menstrual blood—a new dendritic cell source for immune therapy MF Pittenger , AM Mackay , SC Beck , RK Jaiswal , R Douglas , JD Mosca , MA Moorman , DW Simonetti , S Craig , DR Marshak . Multilineage potential of adult human mesenchymal stem cells . Science , 1999 . 284 ( 5411 ): 143 - 147 . 10102814 DOI: 10.1126/science.284.5411.143 http://doi.org/10.1126/science.284.5411.143 . Multilineage potential of adult human mesenchymal stem cells PR Sanberg , DJ Eve , AE Willing , S Garbuzova-Davis , J Tan , CD Sanberg , JG Allickson , LE Cruz , CV Borlongan . The treatment of neurodegenerative disorders using umbilical cord blood and menstrual blood-derived stem cells . Cell Transplant , 2011 . 20 ( 1 ): 85 - 94 . 20887684 DOI: 10.3727/096368910X532855 http://doi.org/10.3727/096368910X532855 . The treatment of neurodegenerative disorders using umbilical cord blood and menstrual blood-derived stem cells X Santamaria , EE Massasa , Y Feng , E Wolff , HS Taylor . Derivation of insulin producing cells from human endometrial stromal stem cells and use in the treatment of murine diabetes . Mol Ther , 2011 . 19 ( 11 ): 2065 - 2071 . 21878900 DOI: 10.1038/mt.2011.173 http://doi.org/10.1038/mt.2011.173 . Derivation of insulin producing cells from human endometrial stromal stem cells and use in the treatment of murine diabetes KE Schwab , CE Gargett . Co-expression of two perivascular cell markers isolates mesenchymal stem-like cells from human endometrium . Hum Reprod , 2007 . 22 ( 11 ): 2903 - 2911 . 17872908 DOI: 10.1093/humrep/dem265 http://doi.org/10.1093/humrep/dem265 . Co-expression of two perivascular cell markers isolates mesenchymal stem-like cells from human endometrium RE Schwartz , M Reyes , L Koodie , Y Jiang , M Blackstad , T Lund , T Lenvik , S Johnson , WS Hu , CM Verfaillie . Multipotent adult progenitor cells from bone marrow differentiate into functional hepatocyte-like cells . J Clin Invest , 2002 . 109 ( 10 ): 1291 - 1302 . 12021244 DOI: 10.1172/JCI15182 http://doi.org/10.1172/JCI15182 . Multipotent adult progenitor cells from bone marrow differentiate into functional hepatocyte-like cells MJ Seo , SY Suh , YC Bae , JS Jung . Differentiation of human adipose stromal cells into hepatic lineage in vitro and in vivo . Biochem Biophys Res Commun , 2005 . 328 ( 1 ): 258 - 264 . 15670778 DOI: 10.1016/j.bbrc.2004.12.158 http://doi.org/10.1016/j.bbrc.2004.12.158 . Differentiation of human adipose stromal cells into hepatic lineage in vitro and in vivo S Snykers , T Vanhaecke , P Papeleu , A Luttun , Y Jiang , Y van der Heyden , C Verfaillie , V Rogiers . Sequential exposure to cytokines reflecting embryogenesis: the key for in vitro differentiation of adult bone marrow stem cells into functional hepatocyte-like cells . Toxicol Sci , 2006 . 94 ( 2 ): 330 - 341 . 16840566 DOI: 10.1093/toxsci/kfl058 http://doi.org/10.1093/toxsci/kfl058 . Sequential exposure to cytokines reflecting embryogenesis: the key for in vitro differentiation of adult bone marrow stem cells into functional hepatocyte-like cells X Stephenne , M Najimi , C Sibille , MC Nassogne , F Smets , EM Sokal . Sustained engraftment and tissue enzyme activity after liver cell transplantation for argininosuccinate lyase deficiency . Gastroenterology , 2006 . 130 ( 4 ): 1317 - 1323 . 16618422 DOI: 10.1053/j.gastro.2006.01.008 http://doi.org/10.1053/j.gastro.2006.01.008 . Sustained engraftment and tissue enzyme activity after liver cell transplantation for argininosuccinate lyase deficiency M Toyoda , C Cui , A Umezawa . Myogenic transdifferentiation of menstrual blood-derived cells . Acta Myol , 2007 . 26 ( 3 ): 176 - 178 . 18646568 . Myogenic transdifferentiation of menstrual blood-derived cells H Yamamoto , G Quinn , A Asari , H Yamanokuchi , T Teratani , M Terada , T Ochiya . Differentiation of embryonic stem cells into hepatocytes: biological functions and therapeutic application . Hepatology , 2003 . 37 ( 5 ): 983 - 993 . 12717379 DOI: 10.1053/jhep.2003.50202 http://doi.org/10.1053/jhep.2003.50202 . Differentiation of embryonic stem cells into hepatocytes: biological functions and therapeutic application J Yu , J Yang , Q Pan , J Ma , J Li , Y Li , H Cao , Y Wang , L Li . In vivo hepatic differentiation of mesenchymal stem cells from human umbilical cord blood after transplantation into mice with liver injury . Biochem Biophys Res Commun , 2012 . 422 ( 4 ): 539 - 545 . 22580002 DOI: 10.1016/j.bbrc.2012.04.156 http://doi.org/10.1016/j.bbrc.2012.04.156 . In vivo hepatic differentiation of mesenchymal stem cells from human umbilical cord blood after transplantation into mice with liver injury We sincerely thank Ping-ping DIAO, Li YUAN, Yi-ming TANG, and Xiao-juan TONG from Zhejiang University (Hangzhou, China) for their technical support and Michael BROWNSTEIN from National Institute of Health (USA) for his critical reading of our manuscript. Compliance with ethics guidelines Xiao-zhou MOU, Jian LIN, Jing-yang CHEN, Yi-fei LI, Xiao-xing WU, Bing-yu XIANG, Cai-yun LI, Ju-ming MA, and Charlie XIANG declare that they have no conflict of interest. All procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the Helsinki Declaration of 1975, as revised in 2000(5). Informed consent was obtained from all patients for being included in the study. Additional informed consent was obtained from all patients for which identifying information is included in this article. All institutional and national guidelines for the care and use of laboratory animals were followed. 10.1631/jzus.B1300081 Project supported by the National High-Tech R&D Program (863) of China (Nos. 2011AA020102 and 2012AA020905), the Key Technologies R&D Program of Zhejiang Province (Nos. 2012C13015-2 and 2011C13029-1), the Hangzhou Key Technologies R&D Program (No. 20122513A49), and the National Natural Science Foundation of China (Nos. 81201783 and 81201089) 2013-03-20 2013-10-15 2013-06-12 2022-01-05 Copyright © Zhejiang University and Springer-Verlag Berlin Heidelberg 2013 2013 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 11 14