Novel mutation c.980_983delATTA compound with c.986C>A mutation of the FRMD7 gene in a Chinese family with X-linked idiopathic congenital nystagmus

Novel mutation c.980_983delATTA compound with c.986C > A mutation of the FRMD7 gene in a Chinese family with X-linked idiopathic congenital nystagmus 1 2 first-author 1 1 corresp ‡Corresponding Author ‡Corresponding Author †E-mail:sunzhaohui2008@gmail.com †E-mail:sunzhaohui2008@gmail.com sunzhaohui2008@gmail.com 3 1 1 1 Eye Center, the Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009, China Eye Center, the Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009, China Department of Ophthalmology, the First Affiliated Hospital of Huzhou Teachers College, Huzhou 313000, China Department of Ophthalmology, the First Affiliated Hospital of Huzhou Teachers College, Huzhou 313000, China Department of Otolaryngology-Head and Neck Surgery, the First Affiliated Hospital, Wenzhou Medical College, Wenzhou 325000, China Department of Otolaryngology-Head and Neck Surgery, the First Affiliated Hospital, Wenzhou Medical College, Wenzhou 325000, China Objective: 2 To screen mutations in FERM domain-containing protein 7 ( FRMD7 ) gene in two Chinese families with X-linked idiopathic congenital nystagmus (XLICN). Methods: 2 Common ophthalmic data and peripheral blood of two Chinese XLICN families (families A and B) were collected after informed consent. Genomic DNA was prepared from the peripheral blood of members of the two families and from 100 normal controls. Mutations in the FRMD7 gene were determined by directly sequencing polymerase chain reaction (PCR) products. Results: 2 We identified a novel mutation c.980_983delATTA compound with c.986C > A mutation in the 11th exon of FRMD7 in family B, and a previously reported splicing mutation c.782G > C (p.R261G) in family A. The mutations were detected in patients and female carriers, while they were absent in other relatives or in the 100 normal controls. Conclusions: 2 Our results expand the spectrum of FRMD7 mutations in association with XLICN, and further confirm that the mutations of FRMD7 are the underlying molecular mechanism for XLICN. Mutation Idiopathic congenital nystagmus FERM domain-containing protein 7 ( FRMD7 ) Introduction 1 Idiopathic congenital nystagmus (ICN) is primarily an oculomotor disorder characterized by bilateral involuntary, periodic, and predominantly ocular oscillations. The symptoms usually present at birth, or develop within the first three months of life. ICN has been found to be the most common type of nystagmus, and the prevalence of ICN is 1.9/10 000 in Leicestershire and Rutland, UK (Sarvananthan et al., 2009 2009 ). Unlike “sensory defect nystagmus”, ICN is independent of any other visual or neurological abnormality. ICN may be inherited as autosomal dominant (OMIM 164100) (Patton et al., 1993 1993 ; Kerrison et al., 1998 1998 ; Klein et al., 1998 1998 ), autosomal recessive (OMIM 257400) (Tarpey et al., 2006 2006 ), or X-linked (OMIM 310700) (Kerrison et al., 1999 1999 ; Tarpey et al., 2006 2006 ). However, the most common mode of inheritance is X-linked, which can be either dominant or recessive, and X-linked loci have been mapped to chromosomes Xq26–q27 (Cabot et al., 1999 1999 ), Xp22 (Bassi et al., 1995 1995 ), and Xp11.3–p11.4 (Kerrison et al., 1999 1999 ). There are two genes that have been identified as disease-causing genes for X-linked ICN (XLICN). GPR143 maps to Xp22, and mutations within it are reported to cause ocular albinism type 1 (OA1), where nystagmus results as a secondary phenotype (Bassi et al., 1995 1995 ). Four-point-one ezrin, radixin, moesin (FERM) domain-containing protein 7 ( FRMD7 ) resides at Xq26–q27, and mutations within it are approximately responsible for the 50% of ICN families (Tarpey et al., 2006 2006 ). However, there have been no responsible genes identified yet from the Xp11.3–p11.4. In this study, we detected a novel mutation c.980_983delATTA compound with c.986C > A mutation in the 11th exon of FRMD7 in a three-generation Chinese XLICN family B, and a previously reported splicing mutation c.782G > C (p.R261G) (Zhang B. et al., 2007 2007 ) in another four-generation Chinese XLICN family A. The mutations in FRMD7 were detected in the patients and carriers, while it was not detected in other healthy family members or in the 100 normal controls. These findings expand on the spectrum of FRMD7 mutations causing XLICN. Materials and methods 1 Patients’ data 2 Forty barley varieties were chosen for this study. Among these accessions, 12 are malting barley varieties released in recent years in China, and 28 are cultivated barley varieties collected from different countries, including the parental lines of several mapping populations and some commercial varieties imported to China as malt barley. Two XLICN families (families A and B) were recruited for this study from the Eye Center of the Second Affiliated Hospital of Zhejiang University, Hangzhou, China. Two patients (IV: 2, IV: 9), one carrier (III: 4), and one healthy member (IV: 10) from family A participated in the study (Fig. 1 1 ). Two patients (III: 1, III: 3), three carriers (II: 2, II: 4, III: 2), and two healthy members (II: 1, III: 5) from family B participated in the study (Fig. 1 1 ). Common ophthalmologic and orthoptic examinations were performed on all participants, including best corrected visual acuity in each eye, slit lamp biomicroscopy, fundus examination, ocular motor examination for strabismus, and binocular sensorial testing. Written consents were obtained from all participants according to the Declaration of Helsinki. The squares represent the males, the circles indicate females, the black-filled symbols signify the affected individuals, the dotted circles indicate the female carriers, and a diagonal line through a symbol represents a deceased family member. The proband is denoted by a black arrow Genomic DNA preparation 2 Peripheral blood specimens (5 ml) were collected in an ethylenediamine tetraacetic acid (EDTA) coated vacutainer (Becton-Dickinson, Franklin Lakes, NJ, USA). We extracted genomic DNA in the peripheral blood leukocytes using a Simgen blood DNA mini kit (Simgen, Hangzhou, China). Genetic analysis 2 The 12 exons and flanking intron sequences of FRMD7 were amplified by the polymerase chain reaction (PCR), using previously reported primers (Du et al., 2011 2011 ; Hu et al., 2012 2012 ). PCR was performed in a volume of 25 μl in a DNA thermal cycler (Perkin Elmer, Norwalk, CT, USA) with primers listed in Table 1 1 . PCR cycling conditions were as follows: 5 min at 95 °C, followed by 10 cycles of touchdown PCR with 1 °C reduction per cycle from 60 °C to 50 °C, followed by 30 cycles with denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 45 s with a final extension step at 72 °C for 10 min. PCR products were isolated by electrophoresis on 1% agarose gels and sequenced using the BigDye terminator cycle sequencing kit V 3.1 (ABI Applied Biosystems; Sangon Co., China) on an ABI PRISM 3730 sequence analyzer, according to the manufacturer’s instructions. Exon Forward primer (5′–3′) Reverse primer (5′–3′) Annealing temperature (°C) Product size (bp) 1 CCTTGGGTGTGCATTACTTC TTTGCTATTGTTGTCCCTTGAG 58 459 2 CGTGCTGCAGTATCAGGTTAG CCCTACATACCTAGCTGCAAAC 58 243 3 TGACATTGCTGTTTGTTTCTACC TCTCAAAGCCCTTTTCTCCC 60 304 4 GAGGGGACGGAAGAGGAGAGC GGCATAACCCCCAAGTGGATAC 61 450 5 ATCTTGGATCTGGGAGAAGG GCTTGGTTCTCTACCTGGC 58 238 6 GAGGACAAGGGTATGCTGGA TCAGGTTTAAGGGCTTGCTC 58 281 7 GAGCTCTCAGGGTGGAAATG ACACCCAAGTTTGAGCCAAG 58 293 8 GGCGGTCCCTCTCATTAAG AAACGATTTGCAGAAACAACC 60 275 9 TTGGGATTTGAAGGTCTTTG TCCTAAGCCTCCTGTGTTATTG 58 301 10+11 TTTAGTAGCCTATTGGTTTATGGC TCAATTCATGGAAGCATTTG 58 401 12a GAGGCTAATTTAGATCCCTCCC CTGGCTTCATTGCAGTGGG 61 620 12b TATGTGGACAAGCCACCCC CTTCAGCAGTTGGTGTGTTG 61 613 12c TGAATCAGAGATTCTTAAACCA ACTGGGCCCCACACAAATAG 61 649 Results 1 Clinical findings 2 Two Chinese families with XLICN were analyzed. No male-to-male transmission was observed. The clinical data of the participants from families A and B are shown in Table 2 2 . In the four-generation Chinese family A (from the Zhejiang province), eight of the sixty-five living family members are affected, including six males and two females. In addition, three females are obligate unaffected carriers. The proband of family A is a seven-year-old boy (family A, individual IV: 2) who has had nystagmus since four or five months after birth. He has a horizontal jerk ocular oscillation without head posture. The best corrected visual acuity of both eyes at distance is 0.2 [in the unit of logarithm of the minimum angle of resolution (logMAR)]. Another affected member of family A (IV: 9) is twenty-six years old with nystagmus since he was four or five months old. He has a horizontal ocular oscillation with little head posture and head shaking, and his best corrected visual acuity for both eyes is 0.1 (in logMAR unit). In family A, the penetrance appears to be complete in males and about 40% in females. logMAR: the logarithm of the minimum angle of resolution. OD: oculus dexter; OS: oculus sinister 2 Family 2 Individual 2 Age (year) 2 Gender 2 Age at onset 2 Best corrected visual acuity at presentation (logMAR unit) 2 Clinical finding OD OS 4 A IV: 2 7 Male 4 or 5 months after birth 0.2 0.2 Horizontal oscillation without head posture IV: 9 26 Male 4 or 5 months after birth 0.1 0.1 Horizontal ocular oscillation with little head posture and head shaking IV: 10 24 Male None 0.0 0.0 Normal III: 4 35 Female None 0.0 0.0 Normal 7 B III: 1 14 Male Since birth 0.3 0.3 Horizontal ocular oscillation with face turn to right and the null point to the left III: 3 30 Male Since birth 0.4 0.4 Horizontal ocular oscillation with little head posture II: 2 39 Female None 0.0 0.1 Normal II: 4 42 Female None 0.0 0.0 Normal III: 2 18 Female None 0.0 0.1 Normal II: 1 43 Male None 0.1 0.0 Normal III: 5 8 Female None 0.0 0.1 Normal In the three-generation Chinese family B (from the Jiangxi Province), two males (III: 1, III: 3) of the eighteen living family members are affected. In addition, three females (II: 2, II: 4, III: 2) are obligate unaffected carriers. The proband of family B is a fourteen-year-old boy (family B, individual III: 1) who has had nystagmus since four or five months after birth. He has a horizontal jerk ocular oscillation, with face turn to right and the null point to the left. The corrected visual acuity of both eyes at distance with the comfortable head posture is 0.3 (in logMAR unit). His sister and mother are asymptomatic obligate carriers. Mutation detected in FRMD7 2 Direct sequencing analysis detected a previously reported splicing mutation in family A, c.782G > C (p.R261G) (Zhang B. et al., 2007 2007 ), at the 9th exon of FRMD7 in affected individuals (Fig. 2 2 ). This splice-site mutation results in substitution of the arginine residue at codon 261 by a glycine residue (p.R261G). Direct sequencing analysis in family B detected a novel mutation c.980_983delATTA compound with c.986C > A mutation in the 11th exon of FRMD7 . This mutation results in substitution of the proline residue at codon 329 by a glutamine residue (p.P329E) and a frame-shift at codon 327 and a putative stop codon 26 amino acids downstream in the translated protein (p.H327PfsX353). These two mutations were confirmed, and were further extended to other family members. These two mutations in FRMD7 were not found in the unaffected members of the family or in the 100 unrelated controls. Two types of FRMD7 mutations were identified in two families, which were previously reported splicing mutation c.782G > C (p.R261G) in family A, and novel mutation c.980_983delATTA compound with c.986C > A mutation in the 11th exon of FRMD7 in family B Discussion 1 The human FRMD7 gene comprises 12 exons spanning approximately 51 kb on chromosome Xq26–q27, and encodes a 714-residue polypeptide. FRMD7 is a member of the super 4.1 family of proteins (Chishti et al., 1998 1998 ), and shares an FERM domain at its NH 2 -terminus (Tarpey et al., 2006 2006 ) with band 4.1, ezrin, moesin, radixin, talin, filopodin, and merlin. The FERM domain of FRMD7 is located between residues 2 and 282, and the FERM adjacent (FA) domain (FERM-adjacent region) is located between residues 288 and 336 (Fig. 3 3 ). It consists of N-terminal FERM domain (green) and FERM adjacent (FA) domain (red). The FERM domain contains 3 lobes F1 (FERM-N), F2 (FERM-M), and F3 (FERM-C). The 48 positions of XLICN mutations have been reported previously (Tarpey et al., 2006 2006 ; Schorderet et al., 2007 2007 ; Self et al., 2007 2007 ; Shiels et al., 2007 2007 ; Zhang B. et al., 2007 2007 ; Zhang Q. et al., 2007 2007 ; He et al., 2008a 2008a ; 2008b 2008b ; Kaplan et al., 2008 2008 ; Li et al., 2008a 2008a ; 2008b 2008b ; 2011 2011 ; Du et al., 2011 2011 ; Khan et al., 2011 2011 ; Thomas et al., 2011 2011 ; Hu et al., 2012 2012 ; Radhakrishna et al., 2012 2012 ) and the novel mutation in this study within FRMD7 has been indicated (Note: for interpretation of the references to color in this figure legend, the reader is referred to the web version of this article) The FERM domain has a three-lobed ‘cloverleaf’ structure; each lobe represents a compactly folded structure. Lobe F1 (FERM-N, N-terminal FERM domain) has a fold resembling ubiquitin; lobe F2 (FERM-M) resembles acyl-CoA binding proteins; and lobe F3 (FERM-C, C-terminal actin-binding domain) has a fold related to pleckstrin homology domain/phosphotyrosine-binding domain (PTB) (Hamada et al., 2000 2000 ; Han et al., 2000 2000 ; Pearson et al., 2000 2000 ; Shimizu et al., 2002 2002 ; Smith et al., 2003 2003 ). The close packing of these domains suggests that they do not function independently, but rather form a co-ordinated structure (Baines, 2006 2006 ). The conserved ezrin/radixin/moesin (ERM) proteins often organize membrane-cytoskeletal interactions (Tsukita and Yonemura, 1999 1999 ), and share a C-terminal actin-binding domain and an N-terminal FERM domain that binds membrane proteins (Mcclatchey and Fehon, 2009 2009 ), also acting as scaffolding for adaptor and signaling molecules (Mcclatchey and Fehon, 2009 2009 ). The FA domain is found next to the FERM domains, and defines a subset of FERM-containing proteins. The conservation of motifs in this region that are potential substrates for kinases, together with the known regulatory phosphorylation of 4.1R in this region, raises the possibility that the FA domain is a regulatory adaptation in this subset of the FERM proteins (Baines, 2006 2006 ). To date, 48 mutations in FRMD7 have been reported worldwide in families with XLICN from various ethnic backgrounds (Fig. 3 3 ) (Tarpey et al., 2006 2006 ; Schorderet et al., 2007 2007 ; Self et al., 2007 2007 ; Shiels et al., 2007 2007 ; Zhang B. et al., 2007 2007 ; Zhang Q. et al., 2007 2007 ; He et al., 2008a 2008a ; 2008b 2008b ; Kaplan et al., 2008 2008 ; Li et al., 2008a 2008a ; 2008b 2008b ; 2011 2011 ; Du et al., 2011 2011 ; Khan et al., 2011 2011 ; Thomas et al., 2011 2011 ; Hu et al., 2012 2012 ; Radhakrishna et al., 2012 2012 ). These mutations include missense, nonsense, splicing mutations, insertions, and deletions. Just under half of the mutations (43%) identified within FRMD7 are predicted to cause gross defects at the protein level due to the introduction of frameshifts, nonsense mutations, and/or aberrant splicing. The other 57% of the mutations identified within FRMD7 are missense mutations. In the present study, we found a novel mutation, c.980_983delATTA compound with c.986C > A mutation, in a three-generation Chinese XLICN family B. The mutations in FRMD7 were detected in the patients and carriers and were not detected in other healthy family members or in 100 normal controls. This supports that the identified mutations cause the pathogenesis of XLICN. The novel mutation c.980_983delATTA (p.H327PfsX353) compound with c.986C > A (p.P329E) mutation locates at the 11th exon of FRMD7 gene, and results in substitution of the proline residue at codon 329 by a glutamine residue causing a frameshift at codon 327 and a putative stop at codon 26 amino acids downstream in the translated protein in the FA domain of FRMD7 . These two changes alter the length of the open reading frame, creating a FRMD7 with an aberrant truncated FA domain. Since the FA domain is thought to be a regulatory adaptation in the FERM proteins, the aberrant truncated FA domain was considered to seriously affect the conservation of motifs in the FA region that are potential substrates for kinases, together with the known regulatory phosphorylation of 4.1R in this region. The FA region is immediately adjacent to FERM domains in all cases, is phosphorylated in vivo by protein kinase A (PKA) and protein kinase C (PKC), and regulates the activities of their neighboring FERM domain (Baines, 2006 2006 ). FRMD7 protein expression may play an important role in regulating neuronal development, particularly in regions of the brain associated with ocular motor control (Betts-Henderson et al., 2010 2010 ). Therefore, the aberrant truncated FA domain caused by the novel mutation may induce XLICN by affecting the activities of the FERM domain protein. The underlying molecular mechanisms for XLICN are not fully understood, but it is anticipated that the spectrum of FRMD7 mutations will provide insights into this condition and the functioning and development of the visual pathways. Our results expand the spectrum of FRMD7 mutations in association with XLICN, and further confirm that the mutations of FRMD7 are the underlying molecular mechanism for XLICN. References AJ Baines . A ferm-adjacent (FA) region defines a subset of the 4.1 superfamily and is a potential regulator of FERM domain function . BMC Genomics , 2006 . 7 85 16626485 DOI: 10.1186/1471-2164-7-85 http://doi.org/10.1186/1471-2164-7-85 . A ferm-adjacent (FA) region defines a subset of the 4.1 superfamily and is a potential regulator of FERM domain function MT Bassi , MV Schiaffino , A Renieri , F de Nigris , L Galli , M Bruttini , M Gebbia , AA Bergen , RA Lewis , A Ballabio . Cloning of the gene for ocular albinism type 1 from the distal short arm of the X chromosome . Nat Genet , 1995 . 10 ( 1 ): 13 - 19 . 7647783 DOI: 10.1038/ng0595-13 http://doi.org/10.1038/ng0595-13 . Cloning of the gene for ocular albinism type 1 from the distal short arm of the X chromosome J Betts-Henderson , S Bartesaghi , M Crosier , S Lindsay , HL Chen , P Salomoni , I Gottlob , P Nicotera . The nystagmus-associated FRMD7 gene regulates neuronal outgrowth and development . Hum Mol Genet , 2010 . 19 ( 2 ): 342 - 351 . 19892780 DOI: 10.1093/hmg/ddp500ddp500 http://doi.org/10.1093/hmg/ddp500ddp500 . The nystagmus-associated FRMD7 gene regulates neuronal outgrowth and development A Cabot , JM Rozet , S Gerber , I Perrault , D Ducroq , A Smahi , E Souied , A Munnich , J Kaplan . A gene for X-linked idiopathic congenital nystagmus (NYS1) maps to chromosome Xp11.4–p11.3 . Am J Hum Genet , 1999 . 64 ( 4 ): 1141 - 1146 . 10090899 . A gene for X-linked idiopathic congenital nystagmus (NYS1) maps to chromosome Xp11.4–p11.3 AH Chishti , AC Kim , SM Marfatia , M Lutchman , M Hanspal , H Jindal , SC Liu , PS Low , GA Rouleau , N Mohandas , 等 . The FERM domain: a unique module involved in the linkage of cytoplasmic proteins to the membrane . Trends Biochem Sci , 1998 . 23 ( 8 ): 281 - 282 . 9757824 . The FERM domain: a unique module involved in the linkage of cytoplasmic proteins to the membrane W Du , J Bu , J Dong , Y Jia , J Li , C Liang , S Si , L Wang . A novel frame-shift mutation in FRMD7 causes X-linked idiopathic congenital nystagmus in a Chinese family . Mol Vis , 2011 . 17 2765 - 2768 . 22065930 . A novel frame-shift mutation in FRMD7 causes X-linked idiopathic congenital nystagmus in a Chinese family K Hamada , T Shimizu , T Matsui , S Tsukita , T Hakoshima . Structural basis of the membrane-targeting and unmasking mechanisms of the radixin FERM domain . EMBO J , 2000 . 19 ( 17 ): 4449 - 4462 . 10970839 DOI: 10.1093/emboj/19.17.4449 http://doi.org/10.1093/emboj/19.17.4449 . Structural basis of the membrane-targeting and unmasking mechanisms of the radixin FERM domain BG Han , W Nunomura , Y Takakuwa , N Mohandas , BK Jap . Protein 4.1R core domain structure and insights into regulation of cytoskeletal organization . Nat Struct Biol , 2000 . 7 ( 10 ): 871 - 875 . 11017195 DOI: 10.1038/82819 http://doi.org/10.1038/82819 . Protein 4.1R core domain structure and insights into regulation of cytoskeletal organization X He , F Gu , Z Wang , C Wang , Y Tong , Y Wang , J Yang , W Liu , M Zhang , X Ma . A novel frameshift mutation in FRMD7 causing X-linked idiopathic congenital nystagmus . Genet Test , 2008 . 12 ( 4 ): 607 - 613 . 19072571 DOI: 10.1089/gte.2008.0070 http://doi.org/10.1089/gte.2008.0070 . A novel frameshift mutation in FRMD7 causing X-linked idiopathic congenital nystagmus X He , F Gu , Y Wang , J Yan , M Zhang , S Huang , X Ma . A novel mutation in FRMD7 causing X-linked idiopathic congenital nystagmus in a large family . Mol Vis , 2008 . 14 56 - 60 . 18246032 . A novel mutation in FRMD7 causing X-linked idiopathic congenital nystagmus in a large family Y Hu , J Shen , S Zhang , T Yang , S Huang , H Yuan . A novel splicing mutation of the FRMD7 gene in a Chinese family with X-linked congenital nystagmus . Mol Vis , 2012 . 18 87 - 91 . 22262942 . A novel splicing mutation of the FRMD7 gene in a Chinese family with X-linked congenital nystagmus Y Kaplan , I Vargel , T Kansu , B Akin , E Rohmann , S Kamaci , E Uz , T Ozcelik , B Wollnik , NA Akarsu . Skewed X inactivation in an X linked nystagmus family resulted from a novel, p.R229G, missense mutation in the FRMD7 gene . Br J Ophthalmol , 2008 . 92 ( 1 ): 135 - 141 . 17962394 DOI: 10.1136/bjo.2007.128157 http://doi.org/10.1136/bjo.2007.128157 . Skewed X inactivation in an X linked nystagmus family resulted from a novel, p.R229G, missense mutation in the FRMD7 gene JB Kerrison , RK Koenekoop , VJ Arnould , D Zee , IH Maumenee . Clinical features of autosomal dominant congenital nystagmus linked to chromosome 6p12 . Am J Ophthalmol , 1998 . 125 ( 1 ): 64 - 70 . 9437315 . Clinical features of autosomal dominant congenital nystagmus linked to chromosome 6p12 JB Kerrison , MR Vagefi , MM Barmada , IH Maumenee . Congenital motor nystagmus linked to Xq26–q27 . Am J Ophthalmol , 1999 . 64 ( 2 ): 600 - 607 . DOI: 10.1086/302244 http://doi.org/10.1086/302244 . Congenital motor nystagmus linked to Xq26–q27 AO Khan , J Shinwari , L Al-Sharif , DS Khalil , N Al Tassan . Prolonged pursuit by optokinetic drum testing in asymptomatic female carriers of novel FRMD7 splice mutation c.1050+5 G > A . Arch Ophthalmol , 2011 . 129 ( 7 ): 936 - 940 . 21746984 DOI: 10.1001/archophthalmol.2011.166 http://doi.org/10.1001/archophthalmol.2011.166 . Prolonged pursuit by optokinetic drum testing in asymptomatic female carriers of novel FRMD7 splice mutation c.1050+5 G>A C Klein , P Vieregge , W Heide , B Kemper , M Hagedorn-Greiwe , J Hagenah , C Vollmer , XO Breakefield , D Kompf , L Ozelius . Exclusion of chromosome regions 6p12 and 15q11, but not chromosome region 7p11, in a German family with autosomal dominant congenital nystagmus . Genomics , 1998 . 54 ( 1 ): 176 - 177 . 9806847 DOI: 10.1006/geno.1998.5535 http://doi.org/10.1006/geno.1998.5535 . Exclusion of chromosome regions 6p12 and 15q11, but not chromosome region 7p11, in a German family with autosomal dominant congenital nystagmus N Li , L Wang , L Cui , L Zhang , S Dai , H Li , X Chen , L Zhu , JF Hejtmancik , K Zhao . Five novel mutations of the FRMD7 gene in Chinese families with X-linked infantile nystagmus . Mol Vis , 2008 . 14 733 - 738 . 18431453 . Five novel mutations of the FRMD7 gene in Chinese families with X-linked infantile nystagmus ND Li , LH Cui , LM Wang , HZ Ma , LL Zhang , YY Yue , KX Zhao . The G990T mutation of the FRMD7 gene in a Chinese family with congenital idiopathic nystagmus . Chin J Med Genet , 2008 . 25 ( 1 ): 11 - 14 . (in Chinese) . The G990T mutation of the FRMD7 gene in a Chinese family with congenital idiopathic nystagmus N Li , X Wang , Y Wang , L Wang , M Ying , R Han , Y Liu , K Zhao . Investigation of the gene mutations in two Chinese families with X-linked infantile nystagmus . Mol Vis , 2011 . 17 461 - 468 . 21365021 . Investigation of the gene mutations in two Chinese families with X-linked infantile nystagmus AI Mcclatchey , RG Fehon . Merlin and the ERM proteins—regulators of receptor distribution and signaling at the cell cortex . Trends Cell Biol , 2009 . 19 ( 5 ): 198 - 206 . 19345106 DOI: 10.1016/j.tcb.2009.02.006 http://doi.org/10.1016/j.tcb.2009.02.006 . Merlin and the ERM proteins—regulators of receptor distribution and signaling at the cell cortex MA Patton , S Jeffery , N Lee , C Hogg . Congenital nystagmus cosegregating with a balanced 7;15 translocation . J Med Genet , 1993 . 30 ( 6 ): 526 - 528 . 8326501 . Congenital nystagmus cosegregating with a balanced 7;15 translocation MA Pearson , D Reczek , A Bretscher , PA Karplus . Structure of the ERM protein moesin reveals the FERM domain fold masked by an extended actin binding tail domain . Cell , 2000 . 101 ( 3 ): 259 - 270 . 10847681 . Structure of the ERM protein moesin reveals the FERM domain fold masked by an extended actin binding tail domain U Radhakrishna , U Ratnamala , S Deutsch , L Bartoloni , MR Kuracha , R Singh , J Banwait , DK Bastola , K Johar , SK Nath , 等 . Novel homozygous, heterozygous and hemizygous FRMD7 gene mutations segregated in the same consanguineous family with congenital X-linked nystagmus . Eur J Hum Genet , 2012 . 20 ( 10 ): 1032 - 1036 . 22490987 DOI: 10.1038/ejhg.2012.60 http://doi.org/10.1038/ejhg.2012.60 . Novel homozygous, heterozygous and hemizygous FRMD7 gene mutations segregated in the same consanguineous family with congenital X-linked nystagmus N Sarvananthan , M Surendran , EO Roberts , S Jain , S Thomas , N Shah , FA Proudlock , JR Thompson , RJ Mclean , C Degg , 等 . The prevalence of nystagmus: the leicestershire nystagmus survey . Invest Ophthalmol Vis Sci , 2009 . 50 ( 11 ): 5201 - 5206 . 19458336 DOI: 10.1167/iovs.09-3486 http://doi.org/10.1167/iovs.09-3486 . The prevalence of nystagmus: the leicestershire nystagmus survey DF Schorderet , L Tiab , MC Gaillard , B Lorenz , G Klainguti , JB Kerrison , EI Traboulsi , FL Munier . Novel mutations in FRMD7 in X-linked congenital nystagmus. Mutation in brief #963. Online . Hum Mutat , 2007 . 28 ( 5 ): 525 17397053 DOI: 10.1002/humu.9492 http://doi.org/10.1002/humu.9492 . Novel mutations in FRMD7 in X-linked congenital nystagmus. Mutation in brief #963. Online JE Self , F Shawkat , CT Malpas , NS Thomas , CM Harris , PR Hodgkins , X Chen , D Trump , AJ Lotery . Allelic variation of the FRMD7 gene in congenital idiopathic nystagmus . Arch Ophthalmol , 2007 . 125 ( 9 ): 1255 - 1263 . 17846367 DOI: 10.1001/archopht.125.9.1255 http://doi.org/10.1001/archopht.125.9.1255 . Allelic variation of the FRMD7 gene in congenital idiopathic nystagmus A Shiels , TM Bennett , JB Prince , L Tychsen . X-linked idiopathic infantile nystagmus associated with a missense mutation in FRMD7 . Mol Vis , 2007 . 13 2233 - 2241 . 18087240 . X-linked idiopathic infantile nystagmus associated with a missense mutation in FRMD7 T Shimizu , A Seto , N Maita , K Hamada , S Tsukita , T Hakoshima . Structural basis for neurofibromatosis type 2. Crystal structure of the merlin ferm domain . J Biol Chem , 2002 . 277 ( 12 ): 10332 - 10336 . 11756419 DOI: 10.1074/jbc.M109979200 http://doi.org/10.1074/jbc.M109979200 . Structural basis for neurofibromatosis type 2. Crystal structure of the merlin ferm domain WJ Smith , N Nassar , A Bretscher , RA Cerione , PA Karplus . Structure of the active N-terminal domain of ezrin. Conformational and mobility changes identify keystone interactions . J Biol Chem , 2003 . 278 ( 7 ): 4949 - 4956 . 12429733 DOI: 10.1074/jbc.M210601200 http://doi.org/10.1074/jbc.M210601200 . Structure of the active N-terminal domain of ezrin. Conformational and mobility changes identify keystone interactions P Tarpey , S Thomas , N Sarvananthan , U Mallya , S Lisgo , CJ Talbot , EO Roberts , M Awan , M Surendran , RJ Mclean , 等 . Mutations in FRMD7 , a newly identified member of the FERM family, cause X-linked idiopathic congenital nystagmus . Nat Genet , 2006 . 38 ( 11 ): 1242 - 1244 . 17013395 DOI: 10.1038/ng1893 http://doi.org/10.1038/ng1893 . Mutations in FRMD7, a newly identified member of the FERM family, cause X-linked idiopathic congenital nystagmus MG Thomas , M Crosier , S Lindsay , A Kumar , S Thomas , M Araki , CJ Talbot , RJ Mclean , M Surendran , K Taylor , 等 . The clinical and molecular genetic features of idiopathic infantile periodic alternating nystagmus . Brain , 2011 . 134 ( Pt3 ): 892 - 902 . 21303855 DOI: 10.1093/brain/awq373 http://doi.org/10.1093/brain/awq373 . The clinical and molecular genetic features of idiopathic infantile periodic alternating nystagmus S Tsukita , S Yonemura . Cortical actin organization: lessons from ERM (ezrin/radixin/moesin) proteins . J Biol Chem , 1999 . 274 ( 49 ): 34507 - 34510 . 10574907 . Cortical actin organization: lessons from ERM (ezrin/radixin/moesin) proteins B Zhang , Z Liu , G Zhao , X Xie , X Yin , Z Hu , S Xu , Q Li , F Song , J Tian , 等 . Novel mutations of the FRMD7 gene in X-linked congenital motor nystagmus . Mol Vis , 2007 . 13 1674 - 1679 . 17893669 . Novel mutations of the FRMD7 gene in X-linked congenital motor nystagmus Q Zhang , X Xiao , S Li , X Guo . FRMD7 mutations in Chinese families with X-linked congenital motor nystagmus . Mol Vis , 2007 . 13 1375 - 1378 . 17768376 . FRMD7 mutations in Chinese families with X-linked congenital motor nystagmus We thank all the affected and unaffected family members that participated in our study. Compliance with ethics guidelines Feng-wei SONG, Bin-bin CHEN, Zhao-hui SUN, Li-ping WU, Su-juan ZHAO, Qi MIAO, and Xia-jing TANG declare that they have no conflict of interest. All procedures followed were in accordance with the ethical standards of the Ethics Committee of the Second Affiliated Hospital, School of Medicine, Zhejiang University, China and with the Helsinki Declaration of 1975, as revised in 2000(5). Informed consent was obtained from all patients for being included in the study. 10.1631/jzus.B1200259 Project supported by the Zhejiang Provincial Science Fund of Health Bureau of China (No. 2012KYA102), the Fundamental Research Funds for the Central Universities (No. 2011FZA7014), the Zhejiang Key Innovation Team Project of China (No. 2009R50039), and the Zhejiang Key Laboratory Fund of China (No. 2011E10006) 2012-09-19 2013-05-17 2013-03-31 2022-01-05 Copyright © Zhejiang University and Springer-Verlag Berlin Heidelberg 2013 2013 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 06 14