Construction of recombinant industrial Saccharomyces cerevisiae strain with bglS gene insertion into PEP4 locus by homologous recombination

Construction of recombinant industrial Saccharomyces cerevisiae strain with bglS gene insertion into PEP4 locus by homologous recombination first-author †E-mail:chenqh@zju.edu.cngqhe@zju.edu.cn †E-mail:chenqh@zju.edu.cngqhe@zju.edu.cn chenqh@zju.edu.cn corresp ‡Corresponding Author ‡Corresponding Author †E-mail:chenqh@zju.edu.cngqhe@zju.edu.cn †E-mail:chenqh@zju.edu.cngqhe@zju.edu.cn chenqh@zju.edu.cn Department of Food Science and Nutrition, Zhejiang University, Hangzhou 310029, China Department of Food Science and Nutrition, Zhejiang University, Hangzhou 310029, China The bglS gene encoding endo -l,3-1,4-β-glucanase from Bacillus subtilis was cloned and sequenced in this study. The bglS expression cassette, including PGK1 promoter, bglS gene fused to the signal sequence of the yeast mating pheromone α-factor ( MFα1 S ), and ADH1 terminator with G418-resistance as the selected marker, was constructed. Then one of the PEP4 allele of Saccharomyces cerevisiae WZ65 strain was replaced by bglS expression cassette using chromosomal integration of polymerase chain reaction (PCR)-mediated homologous recombination, and the bglS gene was expressed simultaneously. The recombinant strain S . cerevisiae (SC-βG) was preliminarily screened by the clearing hydrolysis zone formed after the barley β-glucan was hydrolyzed in the plate and no proteinase A (PrA) activity was measured in fermenting liquor. The results of PCR analysis of genome DNA showed that one of the PEP4 allele had been replaced and bglS gene had been inserted into the locus of PEP4 gene in recombinant strains. Different endo -l,3-1,4-β-glucanase assay methods showed that the recombinant strain SC-βG had high endo -l,3-1,4-β-glucanase expression level with the maximum of 69.3 U/(h·ml) after 60 h of incubation. Meanwhile, the Congo Red method was suitable for the determination of endo -l,3-1,4-β-glucanase activity during the actual brewing process. The current research implies that the constructed yeast strain could be utilized to improve the industrial brewing property of beer. Endo -l,3-1,4-β-glucanase ( bglS ) Gene replacement Homologous recombination Bacillus subtilis PEP4 gene Saccharomyces cerevisiae INTRODUCTION 1 Barley β-glucans (1,3-1,4-β-D-glucans) are the principal constituent (70%) of barley endosperm cell walls (Palmer, 1989 1989 ). β-glucan polymers originating from barley endosperm cell walls are one of the major concerns in the brewing industry. The amount and molecular weight of β-glucan in malt affect brewing house extract yield and wort and beer viscosities, as well as lautering, diatomaceous earth, and membrane filtrations. Barley β-glucans are also associated with beer hazes. The partially degraded β-glucans are particularly troublesome during brewing due to the sticky spent grains which retard wort separation at a lower permeability level, reduce beer filtration rate, and induce beer hazes (Palmer, 1989 1989 ). And also the high viscosities ( Saccharomyces cerevisiae cannot cleave the β-1,4 linkages of β-glucans) impede beer filtration in the presence of β-glucans. Therefore, an addition of commercial enzyme preparations is necessary. Alternatively, a heterologous gene encoding β-glucanase could be introduced into brewer’s yeast. The latter option serves as an obvious task for metabolic engineering whereby the substrate range is extended to include β-glucans, and consequently the process performance of beer production may be improved (Jin et al., 2004 2004 ). Microbial β-glucanases have been used to improve filtration, increase extract yield, and prevent β-glucan hazes. Endo -l,3-1,4-β-glucanases from barley and Bacillus subtilis have identical substrate specificities (Müller et al., 1998 1998 ). Microbial endo -l,3-1,4-β-glucanase can be added during malting, mashing or fermentation procedures (Grujic, 1998 1998 ; Jin et al., 2004 2004 ), which can efficiently lower HMW (high molecular weight) β-glucan content in wort and beer (Todo et al., 1989 1989 ; Kettunen et al., 1996 1996 ), leading to improved beer filterability. The addition of 20×10 −6 of β-glucanase at 0~2 °C for 2 d increases sevenfold the membrane filterability of bright beer (Sudarmana et al., 1996 1996 ). The bacterial endo -l,3-1,4-β-glucanase hydrolyzes linear β-glucans containing β-1,3 and β-1,4 linkages such as cereal β-glucans and lichenan, with a strict cleavage specificity for β-1,4 glycosidic bonds on 3- O -substituted glucosyl residues (Gaiser et al., 2006 2006 ) (Fig. 1 1 ), playing an important biotechnological role in the brewing and animal feedstuff industries. Although the introduction of flocculence to brewer’s yeast is a convenient method to separate the yeast from the brewing, beer filtration is still an important separation technique in the brewing industry. Endo -l,3-1,4-β-glucanases from B . subtilis (Cantwell et al., 1986 1986 ), Trichoderma reesei (Panttilä et al., 1987a 1987a ; 1987b 1987b ), and barley (Olsen and Thomsen, 1989 1989 ) have successfully been expressed in S . cerevisiae , and active enzymes were secreted. The production of β-glucanase did not affect beer quality, and furthermore, the β-glucans were efficiently degraded, resulting in an improved filterability (Panttilä et al., 1987a 1987a ). The appearance of a stable head of foam is a major consideration in beer quality assessment. As a consequence, many researchers have focused on foam-positive species, in particular, beer proteins, which have been implicated to present in the production and stabilization of foam. The decrease in foam stability caused by yeast proteinase A (PrA) in unpasteurized beer has been reported by several researchers (Muldbjerg et al., 1993 1993 ; Yokoi et al., 1996 1996 ; Cooper et al., 2000 2000 ; Wang et al., 2005 2005 ; He et al., 2006 2006 ). PrA is coded by PEP4 gene; construction of PEP4 yeast strains would be helpful to keep foam stability (Wang et al., 2007a 2007a ). Industrial brewing yeast is wild-type original strain in general and it cannot be replaced by laboratorial yeast in beer brewing; however, other researchers have not constructed industrial brewing yeast with PEP4 gene deletion (Akada, 2002 2002 ). In our previous research, it was reported that the PrA-deficient recombinant of industrial brewing yeast (WZ65/a) was constructed using polymerase chain reaction (PCR)-mediated gene disruption (Wang et al., 2007a 2007a ), and self-cloning industrial brewer’s yeast strains were constructed in the following study, in which the coding sequence of PEP4 gene was deleted by CUP1 gene and GSH1 gene’s replacement (Wang et al., 2007b 2007b ). MATERIALS AND METHODS 1 Microbial strains and plasmids 2 The host industrial brewing yeast, WZ65, was provided by China Lion Brewery Group. B . subtilis mutant ZJF-1A5 was isolated and bred to produce thermal stable endo -l,3-1,4-β-glucanase. Escherichia coli DH5α was preserved in the laboratory. Vectors, pUC18 and pUG6 ( KanMX ), were preserved in the laboratory. Media and cultivation conditions 2 Escherichia coli was grown at 37 °C in Luria-Bertani medium supplemented with ampicillin (100 mg/L) when necessary. Yeast strains were grown at 28 °C in YEPD medium (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) glucose). For selection for geneticin (G418) after yeast transformation, the YEPD plate was supplemented with G418 (200 mg/L). Cloning of Bacillus subtilis bglS gene 2 Thermostable bglS gene from B . subtilis ZJF-1A5 was cloned by PCR with designed primers (forward primer, bg-F: 5′-GGGGGATCCATGCCTTATCTGAAACG-3′; reverse primer, bg-D: 5′-GGGAAGCTTATTTACAGAGGGGAGAA-3′). Amplification conditions were 94 °C for 4 min followed by 30 cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min, and finally 72 °C for 10 min. The PCR product was purified and sequenced by Shanghai Sangon Co., China. Construction of recombinant pUC18-KPMBT vector 2 PGK1 promoter, the signal sequence of the yeast mating pheromone α-factor ( MFα1 S ) and ADH1 terminator ( ADH1 T ) fragments were amplified by PCR using S . cerevisiae WZ65 genome as the template with P1 & P2, P3 & P4 and P7 & P8 primers, respectively, adding relevant recognition sites to the 5′-end and 3′-end (Table 1 1 ). And the bglS gene for construction of the recombinant plasmid was amplified by PCR with P5 & P6 primers and B . subtilis as the template. Amplification conditions for the four fragments were 94 °C for 4 min followed by 30 cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min, and finally 72 °C for 10 min. PGK1 P : PGK1 promoter; MFα1 S : Signal sequence of the yeast mating pheromone α-factor; ADH1 T : ADH1 terminator Primer Sequence (5′→3′) Primer site Restriction site P1 CC CCCGGG CTTCAACTCAAGACGCACAG PGK1 P upstream Sma I P1′ CC GGATCCCATATG CTTCAACTCAAGACGCACAG PGK1 P upstream Bam HI, Nde I P2 GG TCTAGA TGTTTTATATTTGTTGTAAAAAGTAG PGK1 P downstream Xba I P3 GG TCTAGA AGAATGAGATTTCCTTC MFα1 S upstream Xba I P4 GGCC AAGCTT CAGCCTCTCTTTTATC MFα1 S downstream Hin dIII P5 GG AAGCTT CGGCTCAAACAGGTGGATCGTTTTTTG bglS upstream Hin dIII P6 GG GGTACC GCATTATTTTTTTGTATAGCGCACCC bglS downstream Kpn I P7 GG GGTACC GCGAATTTCTTATG ADH1 T upstream Kpn I P8 GG GAATTC GCATATCTACAATTGGG ADH1 T downstream Eco RI P9 GG GGATCC CAGCTGAAGCTTCGTACGC KanMX upstream Bam HI P10 CC CCCGGG GCATAGGCCACTAGTGGATCTG KanMX downstream Sma I P11 AGTAAAGAAGTTTGGGTAATTCGCT Verification upstream − P12 AGTGTTCTATGTTTGCCTTGATTTC Verification downstream − P13 5′-gtatttaatccaaataaaattcaaacaaaaaccaaaactaacatgCAGCTGAAGCTTCGTACGC-3′ Gene replacement upstream − P14 5′-atggcagaaaaggatagggcggagaagtaagaaaagtttagctcaGCATATCTACAATTGGG-3′ Gene replacement downstream − PGK1 promoter digested with Bam HI and Xba I was inserted into MCS (multiple clone site) of pUC18, generating pUC18-P. Then the MFα1 S was digested with Xba I and Hin dIII and ligated with the Xba I- and Hin dIII-cleaved pUC18-P, and the resulting plasmid was named pUC18-PM. The bglS gene fragment was cloned into pUC18 after both digested with Hin dIII and Kpn I, resulting in pUC18-B. Then pUC18-B was ligated with Kpn I- and Eco RI-digested ADH1 terminator fragment and was designated as pUC18-BT. Fragment containing PGK1 promoter/the signal sequence of MFα1 factor fusion gene excised with Nde I and Hin dIII from the pUC18-PM was inserted into the same sites of pUC18-BT, and then pUC18-PMBT1 containing Nde I- Eco RI fragment of bglS expression cassette was constructed. The pUC18-PMBT1 was used as a template in PCR with P1 & P8 primers to amply PMBT fragment, and the PCR products were digested with Sma I and Eco RI and inserted into pUC18 to construct pUC18-PMBT. Finally, the KanMX cassette amplified by PCR using pUG6 as a template with P9 and P10 primers was cloned into the pUC18-PMBT at its Bam H and Sma I sites to produce final plasmid (pUC18-KPMBT). Electro-transformation and screening of the recombinants 2 Using recombinant plasmid pUC18-KPMBT as the template, the fragment for replacement was PCR amplified with designed primers, P13 & P14 (Table 1 1 ). At their 3′-ends the oligonucleotides (majuscule) are homologous to the recombinant plasmid pUC18-KPMBT, while the oligonucleotides (lowercase) of the 5′-ends are homologous to the sequence of the left and right of the PEP4 gene, respectively. The PCR product was purified and electro-transformed into industrial yeast S . cerevisiae WZ65. The electro-transformation conditions were: 7.5 kV/cm, capacitance 25 μF, parallel resistor 200 Ω, pulse lengths 5 ms. The transformants were selected on YEPD medium containing 200 mg/L G418. After incubation at 30 °C for 72 h, the recombinants were detected and identified. The two-layer detection plate was used to isolate the transformed strains. The growth YEPD plate with the transformed strains was covered with 5 ml of 0.5% (w/v) agar solution including 0.1% (w/v) lichenan after the transformed colonies were inoculated onto a new YEPD plate to preserve. After incubated at 30 °C for 6 h, the agar-lichenan layer was stained with 0.1% (w/v) Congo Red solution for 30 min. The recombinants were preserved on YEPD slant after the clearing zone formed around the transformed colony in the stained plate. Identification of the recombinant by PCR amplification 2 Using the genome of the recombinant as the template, three pairs of primers, P11 & P10, P12 & P5 and P11 & P12, were designed to verify the recombinant strains, with P11 & P12 located in the flanking region of the PEP4 ORF (open reading frame), upstream 266 bp and downstream 321 bp, respectively (Table 1 1 ). Determination of endo -l,3-1,4-β-glucanase activity 2 After the recombinant SC-βG was incubated in 10 ml YEPD medium at 30 °C for 24 h, 0.5 ml of culturing liquor was inoculated to 50 ml new YEPD medium. Samples were collected at different time points after inoculation. The culture supernatant of recombinant S . cerevisiae WZ65 strain was used as crude enzyme to assay the enzyme activity. 1. Congo Red method 3 The enzyme activity was assayed with barley β-glucan as substrate at 50 °C. Appropriate dilution of the supernatant was done using 0.05 mol/L citrate-phosphate buffer (pH 6.2). For every 900 μl substrate 100 μl supernatant was added. Aliquots (1 ml) were removed in duplicate at intervals, heated (100 °C) for 15 min and cooled to room temperature. Subsequently, 200 μl Congo Red (100 μg/ml) was added and the mixture diluted with buffer to 2 ml. Absorbency was measured at 540 nm (Wood et al., 1988 1988 ). One unit of β-1,3-1,4-glucanase activity is defined as the amount of enzyme required to hydrolyze 1 μg β-glucan per minute in 1 ml fermenting liquor. 2. DNS (3,5-dinitrosalicylic acid) method 3 The activity of endo -l,3-1,4-β-glucanase was measured by a modified method described by Cantwell and McConnell ( 1983 1983 ). The enzyme was appropriately diluted with phosphate buffered saline (PBS) (0.2 mol/L, pH 6.0). An aliquot of 0.1 ml enzyme solution prepared was added to 0.9 ml substrate solution (2 mg/ml lichenin) that was pre-incubated at 50 °C for 10 min, and then the mixture was incubated at 50 °C exactly for 10 min. The reaction was stopped by adding 1.5 ml dinitrosalicylic acid solution and boiling for 5 min. Then, the mixture was cooled immediately with cold water and added to 25 ml with distilled water. Absorbency was measured at 540 nm. The amount of reducing sugar was calculated by the absorption value at 540 nm. One unit of activity was defined as the amount of enzyme capable of producing 1 nmol reducing sugar per minute (using glucose as reference) in 1 ml fermenting liquor under the above conditions. Proteinase A (PrA) activity assay 2 PrA activity was assayed using 1% (w/v) casein (pH 2.0) as the substrate and detecting products with modified Bradford ( 1976 1976 ) method. One unit of PrA will hydrolyze 1 mg of insulin chain B (oxidized) per minute at pH 6.0 (25 °C) (Wang et al., 2005 2005 ). RESULTS 1 bglS gene cloning by PCR amplification 2 To obtain the coding sequence of bglS gene, PCR amplification was performed with the designed pair of primers bg-F/bg-D. The PCR fragment was cloned and then sequenced by Shanghai Sangon. The amplified 849 bp fragment contained a single ORF 729 bp bglS gene (Fig. 2 2 ). The putative protein consisted of 242 amino acids (AA), of which the first 28 AA were predicted to be the signal sequence for the secretion of the protein to the extracellular medium and the rest 214 AA were the mature protein. The first 26 AA of the signal sequence region were deleted, and the rest of the sequence were fused to the signal sequence of MFα1 factor to construct the bglS expression cassette in S . cerevisiae . The stop codon “TAA” was shown by asterisk at the end of the sequence PCR amplification of bglS gene, PGK1 promoter, MFα1 S , ADH1 terminator and the KanMX cassette 2 The PCR products of the PGK1 promoter, MFα1 S , ADH1 terminator and the mature bglS coding sequence were 778, 285, 259 and 654 bp, respectively. KanMX cassette was 1652 bp in length (Fig. 3 3 ). Lane 1: PGK1 promoter; Lane 2: The signal sequence of the yeast mating pheromone α-factor ( MFα1 S ); Lane 3: bglS gene; Lane 4: ADH1 terminator; Lane 5: KanMX cassette Construction and identification of the recombinant vector pUC18-KPMBT 2 The five PCR-amplified fragments were cloned into pUC18 cloning vector to construct recombinant plasmid pUC18-KPMBT ( KanMX - PGK1 P - MFα1 S - bglS - ADH1 T ) according to the process described in the above section. The recombinant plasmid pUC18-KPMBT was shown in Fig. 4 4 . Bam HI and Eco RI were selected to digest the recombinant pUC18-KPMBT plasmid in order to identify the recombinant vector. The digestion results, the 2667 and 3614 bp fragments, were expected. The recombinant plasmid pUC18-KPMBT was also confirmed through PCR verification with P1 & P8 and P9 & P8 primers, resulting in 1976 and 3642 bp products, respectively (Fig. 5 5 ). Sequencing analysis of the recombinant plasmid by Shanghai Sangon Co. indicated that the constructed plasmid was correct. Lane 1: PCR product with P1 & P8 primers; Lane 2: PCR product with P8 & P9 primers; Lane 3: Recombinant plasmid pUC18-KPMBT digested with Bam HI and Eco RI Yeast transformation and screening of the recombinants 2 PCR amplification of the fragment for gene replacement was pooled using P13 & P14 as primers and the recombinant plasmid pUC18-KPMBT as template in 50 μl volume containing 5 μl 10×PCR buffer, 1.2 mmol/L MgCl 2 , 200 μmol/L dNTP, 20 ng of template plasmid, 0.2 μmol/L primers and 2.5 U Taq polymerase. The cycle conditions were 94 °C for 5 min followed by 30 cycles of 94 °C for 40 s, 58 °C for 1 min and 72 °C for 3 min, and finally 72 °C for 10 min. The purified PCR product (~5 μg) was electro-transformed into S . cerevisiae WZ65 strain. The transformation conditions and screening method for the recombinants were described in the previous section. The S . cerevisiae recombinants expressing endo -l,3-1,4-β-glucanase were detected by a clearing zone surrounding the yeast colonies after staining the lichenan-agar upper layer with Congo Red (Fig. 6 6 ). The endo -l,3-1,4-β-glucanase activity was also detected in the supernatant of YEPD liquid cultures. PrA activity was also determined to be zero. The recombinant S . cerevisiae WZ65 strain expressing endo -l,3-1,4-β-glucanase was identified by PCR amplification. Using the recombinant yeast genomic DNA as the template and P11 & P10, P5 & P12, P11 & P12 as primers, PCR amplification was used to verify the recombinant strains, resulting in 1914 and 1273 bp fragments with P11 & P10 and P5 & P12, respectively. The products with P11 & P12 were two fragments, the 4229-bp one for the KMBT and the 1830-bp one for the PEP4 ORF (Fig. 7 7 ). PCR analysis of the bglS -expressed yeast strain showed that the host strain was diploid, and one of the PEP4 alleles was disrupted with the bglS expression cassette and the other was intact. The culture supernatant of recombinant S . cerevisiae WZ65 strain was also used as crude enzyme to determine PrA activity and endo -l,3-1,4-β-glucanase activity. The screened positive transformant was named as SC-βG. Lane 1: PCR product with P11 & P10 primers; Lane 2: PCR product with P5 & P12 primers; Lane 3: PCR product with P11 & P12 primers In considering of high thermostability of endo -1,3-1,4-β-glucanase from B . subtilis compared with that from barley, the cloned Bacillus bglS gene was expressed in S . cerevisiae WZ65 strain to construct the recombinant brewing yeast with the capacity to hydrolyze β-glucans. The Bacillus bglS gene was very lowly expressed in yeast under the control of its own promoter (Hinchliffe and Box, 1984 1984 ) and increased when it was expressed and secreted under the control of ADH1 P ( ADH1 promoter), PGK1 P and signal peptides from yeast (Cantwell et al., 1986 1986 ). In the current research, the ADH1 P and MFα1 S were selected to improve the B . subtilis endo -1,3-1,4-β-glucanase expression efficiency in S . cerevisiae . Endo -l,3-1,4-β-glucanase activity measurement of the recombinant 2 The activity of endo -l,3-1,4-β-glucanase secreted by S . cerevisiae WZ65 was determined by Congo Red method (Fig. 8a 8a ). The glucanase activity of the recombinant strain increased quickly after cultivation for 24 h and reached the maximum of 69.3 U at 60 h. After then, endo -l,3-1,4-β-glucanase activity decreased slowly and was maintained around 50 U after incubation for 72 h. It was supposed that endo -l,3-1,4-β-glucanase expression was inhibited by metabolites (including alcohol, organic acids and other compounds) of SC-βG as cultivation period lasted; however, the deep reason underlined needs to be further investigated in the future research. Furthermore, the β-1,3-1,4-glucanase activity was assayed by DNS method and the same trend as that of Congo Red method was observed (Fig. 8b 8b ). It is relatively difficult to assay endo -1,3-1,4-β-glucanase activity by measuring the amount of reducing sugars. The problem arises due to the fact that there are only a few 1,4- linkages next to 1,3- linkages in barley β-glucan, allowing only a few sites where the enzyme can cut the glucan chain. This results in the production of only a few reducing sugar ends and if measured by the DNS method no effect was detected. Interestingly, although only were a few reducing sugar ends formed, a large clearing zone was formed during the plate assay with Congo Red. Results of the plate assays clearly show that the endo -1,3-1,4-β-glucanase only utilized barley β-glucan and lichenan, but not CMC (carboxymethyl cellulose), whereas the endo -1,4-β-lucanase hydrolyzed all three substrates (van Rensburg et al., 1997 1997 ). Current results confirm that endo -1,3-1,4-β-glucanase only hydrolyzes β-1,4 linkages adjacent to β-1,3 linkages (Wolf et al., 1995 1995 ), because CMC contains no 1,4- linkages next to 1,3- linkages. The two assay methods generated almost the same change curve for the enzyme activity (Fig. 8 8 ). DISCUSSION 1 In the current study, the recombinant industrial brewing yeast strain SC-βG with one of the PEP4 alleles replaced with bglS expression cassette was constructed by PCR-mediated gene disruption and homologous recombination. The recombinant strain may have advantages in beer brewing, maintaining the beer foam performance especially to keep the foam stable in unpasteurized beer, improving beer filterability of brewing and increasing the stability of beer product. PrA plays an essential role among vacuolar hydrolases (Rothman et al., 1986 1986 ; Jones, 1991 1991 ) in processing the mature forms of proteinases B (PrB) and carboxypeptidase Y (CPY) among proteases, alkaline phosphatase and RNase. An initial self-activation process of proteinase yscA is necessary for the activation of vacuolar zymogens (Rupp and Wolf, 1995 1995 ). The inactive precursor molecules produced from the PEP4 gene self-activate and subsequently activate other vacuolar hydrolases (Woolford et al., 1986 1986 ; Ammerer et al., 1986 1986 ). And PEP4 is important for protein turnover after oxidative damage (Marques et al., 2006 2006 ). These roles of PrA are supported by the facts that the deletion of the structural gene of PrA certainly leads to the accumulation of the pro-forms of vacuolar proteases including proPrB and proCPY in the vacuole (Stevens et al., 1982 1982 ). Mutations at the PEP4 locus exhibit a dosage effect on the levels of some, but not all, of the enzymes whose expression requires the function of the gene. The pep4 mutation results in a 90%~95% reduction in the levels of several vacuolar hydrolases in yeast, including PrA and PrB, CPY, RNase(s) and the repressible alkaline phosphatase (Jones et al., 1982 1982 ; Zubenko et al., 1983 1983 ; Stevens et al., 1982 1982 ). In the current work, the recombinant strain SC-βG was constructed for industrial production. Although the recombinant SC-βG yeast would secrete less PrA during beer brewing, the expressed glucanase would hydrolyze β-glucan theoretically. However, the effect of assumed reduction of expressed PrA on foam retention, the growth traits, the fermentative properties of the recombinant S . cerevisiae , and the hydrolytic capability of the recombinant β-glucanase to the β-glucan in the process of beer brewing need to be further investigated. To improve the large-scale production of biotechnological products, it is very important to concentrate on engineering disciplines dealing with bioreactor design and optimization of fermentation technology, which may lead to an improved process performance, giving higher overall yields and productivities (Court et al., 2002 2002 ). The focus on S . cerevisiae to fulfill several biotechnological purposes is still increasing. Since the sequence of the complete yeast genome is available, targeted genetic changes are easily obtained by recombinant DNA technology, which facilitates and accelerates metabolic engineering. References R Akada . Genetically modified industrial yeast ready for application . J Biosci Bioeng , 2002 . 94 ( 6 ): 536 - 544 . 16233347 DOI: 10.1016/S1389-1723(02)80192-X http://doi.org/10.1016/S1389-1723(02)80192-X . Genetically modified industrial yeast ready for application G Ammerer , CP Hunter , JH Rothman , GC Saari , LA Valls , TH Stevens . PEP4 gene of Saccharomyces cerevisiae encodes proteinase A, a vacuolar enzyme required for processing of vacuolar precursors . Mol Cell Biol , 1986 . 6 ( 7 ): 2490 - 2499 . 3023936 . PEP4 gene of Saccharomyces cerevisiae encodes proteinase A, a vacuolar enzyme required for processing of vacuolar precursors P Antoni . Bacterial 1,3-1,4-β-glucanases: structure, function and protein engineering . Biochimi Biophysica Acta , 2000 . 1543 ( 2 ): 361 - 382 . . Bacterial 1,3-1,4-β-glucanases: structure, function and protein engineering MM Bradford . A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding . Anal Biochem , 1976 . 72 ( 1-2 ): 248 - 254 . 942051 DOI: 10.1016/0003-2697(76)90527-3 http://doi.org/10.1016/0003-2697(76)90527-3 . A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding BA Cantwell , DJ McConnell . Molecular cloning and expression of a Bacillus subtilis β-glucanase gene in Escherichia coli . Gene , 1983 . 23 ( 2 ): 211 - 219 . 6311687 DOI: 10.1016/0378-1119(83)90053-7 http://doi.org/10.1016/0378-1119(83)90053-7 . Molecular cloning and expression of a Bacillus subtilis β-glucanase gene in Escherichia coli BA Cantwell , G Brazil , N Murphy , DJ McConnell . Comparison of expression of the endo -β-1,3-1,4-glucanase gene from Bacillus subtilis in Saccharomyces cerevisiae from the CYC1 and ADH1 promoters . Curr Genet , 1986 . 11 ( 1 ): 65 - 70 . 2834081 DOI: 10.1007/BF00389427 http://doi.org/10.1007/BF00389427 . Comparison of expression of the endo-β-1,3-1,4-glucanase gene from Bacillus subtilis in Saccharomyces cerevisiae from the CYC1 and ADH1 promoters DJ Cooper , GG Stewart , JH Bryce . Yeast proteolytic activity during high and low gravity wort fermentations and its effect on head retention . J Inst Brew , 2000 . 1066 ( 4 ): 197 - 201 . . Yeast proteolytic activity during high and low gravity wort fermentations and its effect on head retention DL Court , JA Sawitzke , LC Thomason . Genetic engineering using homologous recombination . Ann Rev Genet , 2002 . 36 ( 1 ): 361 - 388 . 12429697 DOI: 10.1146/annurev.genet.36.061102.093104 http://doi.org/10.1146/annurev.genet.36.061102.093104 . Genetic engineering using homologous recombination OJ Gaiser , K Piotukh , MN Ponnuswamy , A Planas , R Borriss , U Heinemann . Structural basis for the substrate specificity of a Bacillus 1,3-1,4-β-glucanase . J Mol Biol , 2006 . 357 ( 4 ): 1211 - 1225 . 16483609 DOI: 10.1016/j.jmb.2006.01.014 http://doi.org/10.1016/j.jmb.2006.01.014 . Structural basis for the substrate specificity of a Bacillus 1,3-1,4-β-glucanase O Grujic . Application of a commercial enzyme preparation in the barley malting process . J Inst Brew , 1998 . 104 ( 5 ): 249 - 253 . . Application of a commercial enzyme preparation in the barley malting process GQ He , ZY Wang , ZS Liu , QH Chen , H Ruan , PB Schwarz . Relationship of proteinase activity, foam proteins, and head retention in unpasteurized beer . J Am Soc Brew Chem , 2006 . 64 ( 1 ): 33 - 38 . . Relationship of proteinase activity, foam proteins, and head retention in unpasteurized beer E Hinchliffe , WG Box . Expression of the cloned endo -1,3-1,4-β-glucanase gene of Bacillus subtilis in Saccharomyces cerevisiae . Curr Genet , 1984 . 8 ( 6 ): 471 - 475 . DOI: 10.1007/BF00433914 http://doi.org/10.1007/BF00433914 . Expression of the cloned endo-1,3-1,4-β-glucanase gene of Bacillus subtilis in Saccharomyces cerevisiae YL Jin , RA Speers , AT Paulson , RJ Stewart . Barley β-glucans and their degradation during malting and brewing . Technical Quarterly-Master Brewers Association of the Americas , 2004 . 41 ( 3 ): 231 - 240 . . Barley β-glucans and their degradation during malting and brewing EW Jones . Tackling the protease problem in Saccharomyces cerevisiae . Methods Enzymol , 1991 . 194 429 - 453 . . Tackling the protease problem in Saccharomyces cerevisiae EW Jones , GS Zubenko , RR Parker . PEP4 gene function is required for expression of several vacuolar hydrolases in Sacchromyces cerevisiae . Genetics , 1982 . 102 ( 4 ): 665 - 677 . 6764901 . PEP4 gene function is required for expression of several vacuolar hydrolases in Sacchromyces cerevisiae A Kettunen , JJ Hamalainen , K Stenholm , K Pietilä . A model for the prediction of β-glucan concentration during mashing . J Food Eng , 1996 . 29 ( 2 ): 185 - 200 . DOI: 10.1016/0260-8774(95)00070-4 http://doi.org/10.1016/0260-8774(95)00070-4 . A model for the prediction of β-glucan concentration during mashing M Marques , D Mojzita , MA Amorim , T Almeida , S Hohmann , FP Moradas , V Costa . The Pep4p vacuolar proteinase contributes to the turnover of oxidized proteins but PEP4 overexpression is not sufficient to increase chronological lifespan in Saccharomyces cerevisiae . Microbiology , 2006 . 152 ( 12 ): 3595 - 3605 . 17159212 DOI: 10.1099/mic.0.29040-0 http://doi.org/10.1099/mic.0.29040-0 . The Pep4p vacuolar proteinase contributes to the turnover of oxidized proteins but PEP4 overexpression is not sufficient to increase chronological lifespan in Saccharomyces cerevisiae M Muldbjerg , M Meldal , K Breddam , P Sigsgaard . Protease activity in beer and correlation of foam . Proc Congr Eur Brew Conv , 1993 . 25 357 - 364 . . Protease activity in beer and correlation of foam JJ Müller , KK Thomsen , U Heinemann . Crystal structure of barley 1,3-1,4-β-glucanase at 2.0-Å resolution and comparison with Bacillus 1,3-1,4-β-glucanase . J Biol Chem , 1998 . 273 ( 6 ): 3438 - 3446 . 9452466 DOI: 10.1074/jbc.273.6.3438 http://doi.org/10.1074/jbc.273.6.3438 . Crystal structure of barley 1,3-1,4-β-glucanase at 2.0-Å resolution and comparison with Bacillus 1,3-1,4-β-glucanase O Olsen , KK Thomsen . Processing and secretion of barley (1-3,1-4)-β-glucanase in yeast . Carlsberg Res Commun , 1989 . 54 ( 2 ): 29 - 39 . 2673277 DOI: 10.1007/BF02907583 http://doi.org/10.1007/BF02907583 . Processing and secretion of barley (1-3,1-4)-β-glucanase in yeast GH Palmer . GH Palmer . Cereals in Malting and Brewing . Cereal Science and Technology , 1989 . : Aberdeen, UK Aberdeen University Press , 61 - 242 . . Cereals in Malting and Brewing ME Panttilä , L André , M Saloheimo , P Lehtovaara , JK Knowles . Expression of two Trichoderma reesei endoglucanases in the yeast Saccharomyces cerevisiae . Yeast , 1987 . 3 ( 3 ): 175 - 185 . 3332972 DOI: 10.1002/yea.320030305 http://doi.org/10.1002/yea.320030305 . Expression of two Trichoderma reesei endoglucanases in the yeast Saccharomyces cerevisiae ME Panttilä , U Suihko , M Lehtinen , M Nikkola , JKC Knowles . Construction of brewer’s yeasts secreting fungal endo -β-glucanase . Curr Genet , 1987 . 12 ( 6 ): 413 - 420 . DOI: 10.1007/BF00434818 http://doi.org/10.1007/BF00434818 . Construction of brewer’s yeasts secreting fungal endo-β-glucanase JH Rothman , CP Hunter , LA Valls , TH Stevens . Overproduction-induced mislocalization of a yeast vacuolar protein allows isolation of its structural gene . Proc Natl Acad Sci USA , 1986 . 83 ( 10 ): 3248 - 3252 . DOI: 10.1073/pnas.83.10.3248 http://doi.org/10.1073/pnas.83.10.3248 . Overproduction-induced mislocalization of a yeast vacuolar protein allows isolation of its structural gene S Rupp , DH Wolf . The use of active-site mutants of proteinase yscA to determine the necessity of the enzyme for vacuolar proteinase maturation and proteinase yscB stability . Eur J Biochem , 1995 . 231 ( 1 ): 115 - 125 . 7628461 DOI: 10.1111/j.1432-1033.1995.tb20677.x http://doi.org/10.1111/j.1432-1033.1995.tb20677.x . The use of active-site mutants of proteinase yscA to determine the necessity of the enzyme for vacuolar proteinase maturation and proteinase yscB stability TH Stevens , B Esmon , R Schekman . Early stages in the yeast secretory pathway are required for transport of carboxypeptidase Y to the vacuole . Cell , 1982 . 30 ( 2 ): 439 - 448 . 6754086 DOI: 10.1016/0092-8674(82)90241-0 http://doi.org/10.1016/0092-8674(82)90241-0 . Early stages in the yeast secretory pathway are required for transport of carboxypeptidase Y to the vacuole DL Sudarmana , MR Goldsmith , AH Hinh , MA Pecar , DB Hawthorne , TE Kavanagh . Microfiltration studies with a modified membrane filterability procedure . Technical Quarterly-Master Brewers Association of the Americas , 1996 . 33 ( 1 ): 63 - 72 . . Microfiltration studies with a modified membrane filterability procedure V Todo , JV Carbonell , JM Sendra . Kinetics of β-glucan degradation in wort by exogenous β-glucanases treatment . J Inst Brew , 1989 . 95 ( 6 ): 419 - 422 . . Kinetics of β-glucan degradation in wort by exogenous β-glucanases treatment P van Rensburg , WH van Zyl , IS Pretorius . Over-expression of the Saccharomyces cerevisiae exo -β-1,3-glucanase gene together with the Bacillus subtilis endo -β-1,3-1,4-glucanase gene and the Butyrivibrio fibrisolvens endo -β-1,4-glucanase gene in yeast . J Biotechnol , 1997 . 55 ( 1 ): 43 - 53 . 9226961 DOI: 10.1016/S0168-1656(97)00059-X http://doi.org/10.1016/S0168-1656(97)00059-X . Over-expression of the Saccharomyces cerevisiae exo-β-1,3-glucanase gene together with the Bacillus subtilis endo-β-1,3-1,4-glucanase gene and the Butyrivibrio fibrisolvens endo-β-1,4-glucanase gene in yeast ZY Wang , GQ He , ZS Liu , H Ruan , QH Chen , HP Xiong . Purification of yeast proteinase A from fresh beer and its specificity on foam proteins . Int J Food Sci Tech , 2005 . 40 ( 8 ): 835 - 840 . DOI: 10.1111/j.1365-2621.2005.01000.x http://doi.org/10.1111/j.1365-2621.2005.01000.x . Purification of yeast proteinase A from fresh beer and its specificity on foam proteins ZY Wang , GQ He , H Ruan , ZS Liu , LF Yang , BR Zhang . Construction of proteinase A deficient transformant of industrial brewing yeast . Eur Food Res Technol , 2007 . 225 ( 5-6 ): 831 - 835 . DOI: 10.1007/s00217-006-0488-5 http://doi.org/10.1007/s00217-006-0488-5 . Construction of proteinase A deficient transformant of industrial brewing yeast ZY Wang , XP He , BR Zhang . Over-expression of GSH1 gene and disruption of PEP4 gene in self-cloning industrial brewer’s yeast . Int J Food Microbiol , 2007 . 119 ( 3 ): 192 - 199 . 17881073 DOI: 10.1016/j.ijfoodmicro.2007.07.015 http://doi.org/10.1016/j.ijfoodmicro.2007.07.015 . Over-expression of GSH1 gene and disruption of PEP4 gene in self-cloning industrial brewer’s yeast M Wolf , G Attila , S Ortwin , B Rainer . Genes encoding xylan and β-glucan hydrolyzing enzymes in Bacillus subtilis : characterization, mapping and construction of strain deficient in lichenase, cellulose and xylanase . Microbiology , 1995 . 141 ( 2 ): 281 - 290 . 7704256 . Genes encoding xylan and β-glucan hydrolyzing enzymes in Bacillus subtilis: characterization, mapping and construction of strain deficient in lichenase, cellulose and xylanase PJ Wood , JD Erfle , RM Teather . Use of complex formation between Congo Red and polysaccharides hydrolases in detection and assay of polysaccharide hydrolases . Methods Enzymol , 1988 . 160 59 - 74 . . Use of complex formation between Congo Red and polysaccharides hydrolases in detection and assay of polysaccharide hydrolases CA Woolford , LB Daniels , FJ Park , EW Jones , JV Arsdell , MA Innis . The PEP4 gene encodes an aspartyl protease implicated in the posttranslational regulation of Saccharomyces cerevisae vacuolar hydrolases . Mol Cell Biol , 1986 . 6 ( 7 ): 2500 - 2510 . 3537721 . The PEP4 gene encodes an aspartyl protease implicated in the posttranslational regulation of Saccharomyces cerevisae vacuolar hydrolases S Yokoi , T Shigyo , T Tamaki . A fluorometric assay for proteinase A in beer and its application for investigation of enzymatic effects on foam stability . J Inst Brew , 1996 . 1022 ( 1 ): 33 - 37 . . A fluorometric assay for proteinase A in beer and its application for investigation of enzymatic effects on foam stability GS Zubenko , FJ Park , EW Jones . Mutations in PEP4 locus of Saccharomyces cerevisiae block final step in maturation of two vacuolar hydrolases . Proc Natl Acad Sci USA , 1983 . 80 ( 2 ): 510 - 514 . . Mutations in PEP4 locus of Saccharomyces cerevisiae block final step in maturation of two vacuolar hydrolases 10.1631/jzus.B0820019 Project supported by the National Hi-Tech Research and Development Program (863) of China (No. 2007AA10Z315) and the Natural Science Foundation of Zhejiang Province, China (No. Z304076) 2008-01-16 2008-04-26 2022-01-05 Copyright © 2008, Journal of Zhejiang University Science 2008 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 07 09