Assignment of CCR7 gene to chicken chromosome 27 by radiation hybrid panel mapping

Assignment of CCR7 gene to chicken chromosome 27 by radiation hybrid panel mapping 1 2 first-author 2 1 2 2 2 2 1 corresp ‡Corresponding Author ‡Corresponding Author †E-mail:yzhzh@zju.edu.cn †E-mail:yzhzh@zju.edu.cn yzhzh@zju.edu.cn Laboratory of Animal Genetics, College of Animal Sciences, Zhejiang University, Hangzhou 310029, China Laboratory of Animal Genetics, College of Animal Sciences, Zhejiang University, Hangzhou 310029, China Institute of Animal Husbandry and Veterinary Science, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China Institute of Animal Husbandry and Veterinary Science, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China The protein encoded by CC chemokine receptor 7 ( CCR7 ) is a member of the G protein-coupled receptor family. This receptor was identified as a gene induced by the Epstein-Barr virus (EBV), and is thought to be a mediator of EBV effects on B lymphocytes. This receptor is expressed in various lymphoid tissues and activates B and T lymphocytes. It has been shown to control the migration of memory T cells to inflamed tissues, as well as stimulate dendritic cell maturation. To map the CCR7 gene in chicken chromosome, a 6 000 rads chicken-hamster radiation hybrid panel (ChickRH6) was used. PCR of samples from ChickRH6 revealed that the location of CCR7 gene is linked to the maker SEQ0347 (6 cR away) with LOD score of 16.6 and that the marker SEQ0347 is located on chromosome 27 at 27 cR of RH (radiation hydrid) map. We compared the corresponding human mRNA sequence with the predicted coding sequence of chicken CCR7 gene, and found that the assembled contig shared a high percentage of similarity with that of the human gene. Radiation hybrid panel Mapping CCR7 gene Chicken INTRODUCTION 1 Chemokine receptors are members of the family of seven transmembrane-spanning (7 TMS) proteins that signal through heterotrimeric G proteins upon ligand binding. At a total length of 340 to 370 amino acids, they are composed of seven hydrophobic transmembrane domains with an extracellular N-terminal segment and a cytoplasmic C-terminal tail containing structural motifs which are critical for ligand dependent signalling, desensitization, and receptor trafficking. Chemokine receptor nomenclature is simply based on the chemokine group (CC, CXC, C or CX3C) to which its ligand(s) belong (Rollins, 1997 1997 ; Murphy et al., 2000 2000 ), and the protein encoded by CC chemokine receptor 7 ( CCR7 ) belongs to the CC group. The gene for CCR7 is on human chromosome 17q12-21.2 (Schweickart et al., 1994 1994 ). The open reading frame is on two exons separated by an intron in the N-terminal domain, and predicts a polypeptide of 378 amino acids. The chemokine (C-C motif) ligands 19 (CCL19/ECL) and 21 (CCL21/SLC) have been reported to be specific ligands of this receptor (Rossi et al., 1997 1997 ; Yoshida et al., 1997 1997 ; 1998 1998 ). Consistent with the chemotactic action of CCL19/MIP-3β and CCL21/SLC on lymphocytes and DCs (dendritic cells), CCR7 expression can be demonstrated on T cells and on mature dendritic cells (Sallusto et al., 1998 1998 ; Willimann et al., 1998 1998 ; Jang et al., 2006 2006 ). Important functions of CCR7 have been shown to control the migration of memory T cells to inflamed tissues and stimulate dendritic cell maturation (Dieu et al., 1998 1998 ; Sallusto and Lanzavecchia, 2000 2000 ; Lipp and Muller, 2003 2003 ). In the CNS (central nervous system), microglia express CCR7 under specific inflammatory conditions (Dijkstra et al., 2006 2006 ). CCR7 activates two independent signaling modules, one involving G(i)-dependent activation of MAPK members ERK1/2, JNK and p38 and a hierarchy of MAPK family members and another involving Rho/Pyk2/cofilin, which control chemotaxis and the migratory speed of dendritic cells, respectively (Iijima et al., 2005 2005 ; Riol-Blanco et al., 2005 2005 ; Okada and Cyster, 2007 2007 ). It has been demonstrated that CCR7 is endocytosed into early endosomes containing transferrin receptor upon CCL19 binding, but less upon CCL21 triggering (Otero et al., 2006 2006 ). In spite of our knowledge of CCR7 in human, its functional and hereditary mechanism in chicken is not fully understood. In the present study, precise localization of CCR7 gene was first performed by RH (radiation hybrid) mapping in chicken. We also compared the predicted coding region of chicken CCR7 with that of the human gene. MATERIALS AND METHODS 1 Primers design, PCR conditions and sequencing 2 The PCR primers for the chicken CCR7 sequence were designed using Oligo 6.0 software (MBI Cascade Co., USA) supplied from Integrated Technologies Inc. (Coralville, IA, USA). Based on consensus sequences from human (GenBank accession No. NC_000017) and mouse (GenBank accession No. NC_000077), primers were designed to amplify chicken CCR7 genomic sequence (Table 1 1 ). Identity scores after comparison of predicted coding region with the human sequence Primers used for sequencing Primers used for mapping Gene GenBank accession No. (chicken/human) Sequence similarity to human (%) a a Primer sequences (5′→3′) Size (bp) CCR7 EF092460/NM_001838 76 PF b b : GAGATGATGTGTGAGAAGAAGG 749 PR b b c c : CTGGTGTTGTTGAAGACTGAG PF c c : GGTGTTTTGGAGTATTTGCCT 517 The PCR was performed in a 25 μl reaction mixture containing 0.8 U Taq DNA polymerase (Takara, Dalian, China), 1×PCR buffer, 1.5 mmol/L MgCl 2 , 200 μmol/L of each dNTP, 0.5 μmol/L of each primer and approximately 50 ng of genomic DNA. The thermal cycling profile was 95 °C for 5 min, 35 cycles of 94 °C for 45 s, 57 °C for 45 s and 72 °C for 1 min, with final extension of 72 °C for 10 min. The amplified product was analyzed by electrophoresis on 1.5% agarose gel in 0.5×TBE buffer and sequenced in 3730 DNA analyzer (Applied Biosystems, CA, USA). A 749 bp nucleotide sequence was obtained. We have deposited the sequence in GenBank (GenBank accession No. EF092460). Identity of the PCR product was confirmed by sequence analysis. Using previously described sequence, new primers of chicken CCR7 gene were designed for RH mapping (Table 1 1 ). In all cases, the primers designed for RH mapping only amplified chicken genomic DNA, but not hamster controls. Radiation hybrid mapping 2 Chromosomal localization was performed with the INRA chicken radiation hybrid panel (ChickRH6) containing 90 hamster-chicken hybrid cell lines (Morisson et al., 2002 2002 ). The PCR was performed in 10 μl reactions containing 30 ng of genomic DNA, 0.3 U Taq DNA polymerase (Takara, Dalian, China), 1×PCR buffer, 1.5 mmol/L MgCl 2 , 200 μmol/L of each dNTP, 0.5 μmol/L of each primer. The thermal cycling profile was 95 °C for 5 min, 35 cycles of 94 °C for 45 s, 55 °C for 45 s and 72 °C for 1 min, with final extension of 72 °C for 10 min. The amplified product was 517 bp and separated on 1.5% agarose gel in 0.5×TBE buffer. The gene was typed in duplicate with the chicken ChickRH6 panel, and the results are scored as present (1) and absent (0), or ambiguous (2) as directed (Morisson et al., 2002 2002 ). Two-point results were calculated and multipoint radiation hybrid maps (see APPENDIX A) were built with ChickRH server ( http://chickrh.toulouse.inra.fr/ http://chickrh.toulouse.inra.fr/ ). Linkage groups were assigned using a minimum LOD score threshold of 2.0. The RH mapping data are summarized in Table 2 2 . Retention frequency Chromosome localization of the closest marker on the RH map (RH map units) Distance between the CCR7 gene and the closest marker (RH map units) with two-point analysis 2 Gene 6 Chicken RH mapping result RF d d (%) Closest marker Chromosome RH map (cR) e e Distance (cR) f f LOD score CCR7 22 SEQ0347 27 27 6 16.6 RESULTS AND DISCUSSION 1 The radiation hybrid panel showed the following distribution of positive and negative amplifications within the 90 clones: 00000 00000 00000 00010 00010 00001 01001 00000 01000 00100 10000 01111 00000 10010 00200 01100 01101 10000 for CCR7 . A retention frequency (RF) of 22% was calculated based on twenty chicken-specific PCR bands, and this RF value is higher than the mean RF of 21.9% observed in other studies reported in this panel (Morisson et al., 2002 2002 ). Two-point LOD scores showed that CCR7 is linked to SEQ0347 (6 cR away) with an LOD score of 16.6. The marker SEQ0347 is located on chromosome 27 at 27 cR of RH map (Table 2 2 ). Comparing the human mRNA sequence with the predicted coding sequence of chicken CCR7 gene using bl2seq software provided by NCBI server ( http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi ), we found that the assembled contig shared a high percentage of similarity with that of the human gene. The results revealed that the expected chicken gene sequence was isolated. In conclusion, our present results revealed that the chicken CCR7 gene is located on chromosome 27 at 6 cR of the marker SEQ0347 (LOD score 16.6). This study suggests a new method for CCR7 gene mapping in chicken. References MC Dieu , B Vanbervliet , A Vicari , JM Bridon , E Oldham , S Ait-Yahia , F Briere , A Zlotnik , S Lebecque , C Caux . Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites . J Exp Med , 1998 . 188 ( 2 ): 373 - 386 . DOI: 10.1084/jem.188.2.373 http://doi.org/10.1084/jem.188.2.373 . Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites IM Dijkstra , AH de Haas , N Brouwer , HW Boddeke , K Biber . Challenge with innate and protein antigens induces CCR7 expression by microglia in vitro and in vivo . Glia , 2006 . 54 ( 8 ): 861 - 872 . DOI: 10.1002/glia.20426 http://doi.org/10.1002/glia.20426 . Challenge with innate and protein antigens induces CCR7 expression by microglia in vitro and in vivo N Iijima , Y Yanagawa , JM Clingan , K Onoe . CCR7-mediated c-Jun N-terminal kinase activation regulates cell migration in mature dendritic cells . Int Immunol , 2005 . 17 ( 9 ): 1201 - 1212 . DOI: 10.1093/intimm/dxh297 http://doi.org/10.1093/intimm/dxh297 . CCR7-mediated c-Jun N-terminal kinase activation regulates cell migration in mature dendritic cells MH Jang , N Sougawa , T Tanaka , T Hirata , T Hiroi , K Tohya , Z Guo , E Umemoto , Y Ebisuno , BG Yang , 等 . CCR7 is critically important for migration of dendritic cells in intestinal lamina propria to mesenteric lymph nodes . J Immunol , 2006 . 176 ( 2 ): 803 - 810 . . CCR7 is critically important for migration of dendritic cells in intestinal lamina propria to mesenteric lymph nodes M Lipp , G Muller . Shaping up adaptive immunity: the impact of CCR7 and CXCR5 on lymphocyte trafficking . Verh Dtsch Ges Pathol , 2003 . 87 90 - 101 . . Shaping up adaptive immunity: the impact of CCR7 and CXCR5 on lymphocyte trafficking M Morisson , A Lemiere , S Bosc , M Galan , F Plisson-Petit , P Pinton , C Delcros , K Feve , F Pitel , V Fillon , 等 . ChickRH6: a chicken whole-genome radiation hybrid panel . Genet Sel Evol , 2002 . 34 ( 4 ): 521 - 533 . DOI: 10.1051/gse:2002021 http://doi.org/10.1051/gse:2002021 . ChickRH6: a chicken whole-genome radiation hybrid panel PM Murphy , M Baggiolini , IF Charo , CA Hebert , R Horuk , K Matsushima , LH Miller , JJ Oppenheim , CA Power . International union of pharmacology. XXII. Nomenclature for chemokine receptors . Pharmacol Rev , 2000 . 52 ( 1 ): 145 - 176 . . International union of pharmacology. XXII. Nomenclature for chemokine receptors T Okada , JG Cyster . CC chemokine receptor 7 contributes to Gi-dependent T cell motility in the lymph node . J Immunol , 2007 . 178 ( 5 ): 2973 - 2978 . . CC chemokine receptor 7 contributes to Gi-dependent T cell motility in the lymph node C Otero , M Groettrup , DF Legler . Opposite fate of endocytosed CCR7 and its ligands: recycling versus degradation . J Immunol , 2006 . 177 ( 4 ): 2314 - 2323 . . Opposite fate of endocytosed CCR7 and its ligands: recycling versus degradation L Riol-Blanco , N Sanchez-Sanchez , A Torres , A Tejedor , S Narumiya , AL Corbi , P Sanchez-Mateos , JL Rodriguez-Fernandez . The chemokine receptor CCR7 activates in dendritic cells two signaling modules that independently regulate chemotaxis and migratory speed . J Immunol , 2005 . 174 ( 7 ): 4070 - 4080 . . The chemokine receptor CCR7 activates in dendritic cells two signaling modules that independently regulate chemotaxis and migratory speed BJ Rollins . Chemokines . Blood , 1997 . 90 ( 3 ): 909 - 928 . . Chemokines DL Rossi , AP Vicari , K Franz-Bacon , TK McClanahan , A Zlotnik . Identification through bioinformatics of two new macrophage proinflammatory human chemokines: MIP-3alpha and MIP-3beta . J Immunol , 1997 . 158 ( 3 ): 1033 - 1036 . . Identification through bioinformatics of two new macrophage proinflammatory human chemokines: MIP-3alpha and MIP-3beta F Sallusto , A Lanzavecchia . Understanding dendritic cell and T-lymphocyte traffic through the analysis of chemokine receptor expression . Immunol Rev , 2000 . 177 ( 1 ): 134 - 140 . DOI: 10.1034/j.1600-065X.2000.17717.x http://doi.org/10.1034/j.1600-065X.2000.17717.x . Understanding dendritic cell and T-lymphocyte traffic through the analysis of chemokine receptor expression F Sallusto , P Schaerli , P Loetscher , C Schaniel , D Lenig , CR Mackay , S Qin , A Lanzavecchia . Rapid and coordinated switch in chemokine receptor expression during dendritic cell maturation . Eur J Immunol , 1998 . 28 ( 9 ): 2760 - 2769 . DOI: 10.1002/(SICI)1521-4141(199809)28:09<2760::AID-IMMU2760>3.0.CO;2-N http://doi.org/10.1002/(SICI)1521-4141(199809)28:09<2760::AID-IMMU2760>3.0.CO;2-N . Rapid and coordinated switch in chemokine receptor expression during dendritic cell maturation VL Schweickart , CJ Raport , R Godiska , MG Byers , RLJr Eddy , TB Shows , PW Gray . Cloning of human and mouse EBI1, a lymphoid-specific G-protein-coupled receptor encoded on human chromosome 17q12-q21.2 . Genomics , 1994 . 23 ( 3 ): 643 - 650 . DOI: 10.1006/geno.1994.1553 http://doi.org/10.1006/geno.1994.1553 . Cloning of human and mouse EBI1, a lymphoid-specific G-protein-coupled receptor encoded on human chromosome 17q12-q21.2 K Willimann , DF Legler , M Loetscher , RS Roos , MB Delgado , I Clark-Lewis , M Baggiolini , B Moser . The chemokine SLC is expressed in T cell areas of lymph nodes and mucosal lymphoid tissues and attracts activated T cells via CCR7 . Eur J Immunol , 1998 . 28 ( 6 ): 2025 - 2034 . DOI: 10.1002/(SICI)1521-4141(199806)28:06<2025::AID-IMMU2025>3.0.CO;2-C http://doi.org/10.1002/(SICI)1521-4141(199806)28:06<2025::AID-IMMU2025>3.0.CO;2-C . The chemokine SLC is expressed in T cell areas of lymph nodes and mucosal lymphoid tissues and attracts activated T cells via CCR7 R Yoshida , T Imai , K Hieshima , J Kusuda , M Baba , M Kitaura , M Nishimura , M Kakizaki , H Nomiyama , O Yoshie . Molecular cloning of a novel human CC chemokine EBI1-ligand chemokine that is a specific functional ligand for EBI1, CCR7 . J Biol Chem , 1997 . 272 ( 21 ): 13803 - 13809 . DOI: 10.1074/jbc.272.21.13803 http://doi.org/10.1074/jbc.272.21.13803 . Molecular cloning of a novel human CC chemokine EBI1-ligand chemokine that is a specific functional ligand for EBI1, CCR7 R Yoshida , M Nagira , M Kitaura , N Imagawa , T Imai , O Yoshie . Secondary lymphoid-tissue chemokine is a functional ligand for the CC chemokine receptor CCR7 . J Biol Chem , 1998 . 273 ( 12 ): 7118 - 7122 . DOI: 10.1074/jbc.273.12.7118 http://doi.org/10.1074/jbc.273.12.7118 . Secondary lymphoid-tissue chemokine is a functional ligand for the CC chemokine receptor CCR7 We thank INRA, Laboratoire de Genetique Cellulaire, Institut National de la Recherche Agronomique for supplying the Chicken hybrid panel. 10.1631/jzus.2007.B0314 Project (No. 2005C12005-01) supported by the Significant Project of Science and Technology of Zhejiang Province, China 2007-01-04 2007-03-14 2022-01-05 Copyright © 2007, Journal of Zhejiang University Science 2007 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 05 08