A TOM1 homologue is required for multiplication of Tobacco mosaic virus in Nicotiana benthamiana

A TOM1 homologue is required for multiplication of Tobacco mosaic virus in Nicotiana benthamiana 1 first-author 1 2 1 corresp ‡Corresponding Author ‡Corresponding Author †E-mail:zzhou@zju.edu.cn †E-mail:zzhou@zju.edu.cn zzhou@zju.edu.cn State Key Laboratory of Rice Biology, Institute of Biotechnology, Zhejiang University, Hangzhou 310029, China State Key Laboratory of Rice Biology, Institute of Biotechnology, Zhejiang University, Hangzhou 310029, China College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China The AtTOM1 gene of Arabidopsis thaliana had been shown to be essential for the efficient multiplication of Tobacco mosaic virus (TMV) in A . thaliana . In this study, we cloned an AtTOM1 -like gene from Nicotiana benthamiana named as NbTOM1 . Sequence alignment showed that NbTOM1 is closely related to AtTOM1 homologues of N . tabacum and Lycopersicon esculentum with 97.2% and 92.6% nucleotide sequence identities, respectively. Silencing of NbTOM1 by a modified viral satellite DNA-based vector resulted in complete inhibition of the multiplication of TMV in N . benthamiana . The result suggests that inhibition of NbTOM1 via RNA silencing is a potentially useful method for generating TMV-resistant plants. Tobacco mosaic virus NbTOM1 Virus induced gene silencing Nicotiana benthamiana INTRODUCTION 1 Viral diseases have caused significant yield and quality losses in crop production. Over the past years, transgenic approaches have successfully generated virus-resistant plants (Goldbach et al., 2003 2003 ). An effective method for obtaining resistant transgenic plants is to induce RNA silencing by expressing virus-derived dsRNA in plants (Zhang et al., 2005 2005 ). A variety of host factors were identified to be involved in the intracellular multiplication of viruses (Lai, 1998 1998 ; Lee et al., 2001 2001 ; Noueiry et al., 2000 2000 ). Previous studies showed that AtTOM1 and AtTOM3 of Arabidopsis thaliana , which encode a putative seven-pass transmembrane protein, are essential for the efficient multiplication of a crucifer-infecting tobamovirus (TMV-Cg) (Hagiwara et al., 2003 2003 ; Yamanaka et al., 2000 2000 ; 2002 2002 ). Two AtTOM1 homologues, NtTOM1 and NtTOM3 , were identified in Nicotiana tabacum . Simultaneous RNA interference against NtTOM1 and NtTOM3 in N . tabacum successfully inhibited the multiplication of Tomato mosaic virus and other tobamoviruses (Asano et al. 2005 2005 ). AtTOM1 and AtTOM3 homologues are present in various plant species and their inhibition via RNA interference should constitute a useful method for generating tobamovirus-resistant plants (Asano et al., 2005 2005 ). In this study, we identified an AtTOM1 -like gene in N . benthamiana , named as NbTOM1 and reported that silencing of NbTOM1 by a modified viral satellite DNA-based vector results in complete inhibition of Tobacco mosaic virus (TMV) multiplication in N . benthamiana . MATERIALS AND METHODS 1 Isolation of TOM1 homologue and construction of gene silencing vector 2 To identify TOM1 homologue in N . benthamiana , total RNA from N . benthamiana leaves was prepared using Trizol reagent (Invitrogen, Carlsbad, CA, USA), and applied as a template for first-strand cDNA synthesis using oligo d(T) 18 and superscript reverse transcriptase (TaKaRa, Shiga, Japan). The TOM1 homologue fragment was PCR-amplified with the degenerated primers TOM1F (5′ CTTTGTYGTVAAYGGAGTTC 3′) and TOM1R (5′ GTAYTGWGCWGAYACTC 3′) (V=A, C, G; W=A, T; Y=C, T) using the synthesized first-strand cDNA as template. The resulting PCR product was cloned into pGEM-Teasy vector (Promega, Madison, WI, USA) and then sequenced. Based on the fragment sequence, primers TOM1F1 (5′ TCTAGA CTATTGTCTTTGGATTTCACA 3′, restriction site for Bam HI is underlined) and TOM1R1 (5′ GGATCC AGGCAATTTTCGCAGGATG 3′, restriction site for Xba I is underlined) were designed. The resulting PCR product was digested with Bam HI- Xba I and inserted into the Bam HI- Xba I-cut DNAβ vector of Tomato yellow leaf curl China virus (TYLCCNV) (DNAmβ) (Tao and Zhou, 2004 2004 ) to produce construct DNAmβ:NbTOM1. The infectious clone of DNAmβ and TYLCCNV was constructed previously by the authors’ lab (Cui et al., 2004 2004 ; Tao and Zhou, 2004 2004 ). Agroinoculation of plants 2 DNAmβ:NbTOM1 were introduced into Agrobacterium tumefaciens strain PGV3850 by electropolation. A . tumefaciens cultures containing infectious clone of TYLCCNV and DNAmβ:NbTOM1 were injected into stems of N . benthamiana seedlings at six-leaf stage as previously described (Zhou et al., 2003 2003 ). Plants co-inoculated with TYLCCNV and DNAmβ empty vector or water were used as control. Inoculated plants were grown in an insect-free cabinet at a constant temperature of 25 °C with supplementary lighting for 16 h per day. Virus inoculation 2 TMV:GFP (green fluorescent protein) carrying the mGFP4 gene was kindly provided by the Sainsbury Laboratory of John Innes Centre. The virus was agro-infiltrated into the sixth true leaf. GFP image 2 GFP was detected visually in intact plants with the aid of a hand-held 100 W long-wave ultraviolet lamp (UV products, Upland, CA, USA). Plants were photographed with a Nikon 5 000 digital camera and the images were processed using Adobe Photoshop software. Semi-quantitative RT-PCR 2 Semi-quantitative RT-PCR was performed as described by Tao and Zhou ( 2004 2004 ). cDNA derived from the equivalent of 1 µg of total RNA was used as a template. Primers (TOM1F, TOM1R) that anneal outside the region targeted for silencing were used to ensure that only the endogenous gene transcript was assayed. The elongation factor 1-alpha ( EF-1-α ) served as an internal control for RNA quantity in RT-PCR. The intensities of PCR-generated fragments were analyzed and quantified using Gel-Pro Analyzer 3.1 (Media Cybernetics, Atlanta, GA, USA). RNA gel blot analysis 2 Total RNA isolation using systemic leaves and Northern blot analysis were conducted as described previously (Cui et al., 2004 2004 ). Membranes were hybridized with [α- 32 P]dCTP-labelled probe specific for the TMV movement protein gene. Hybridization signals were detected by phosphorimaging using a Typhoon 9200 imager (Amersham Pharmacia, Piscataway, NJ, USA). RESULTS AND DISCUSSION 1 AtTOM1 homologues were found in Lycopersicon esculentum (AB193043) Oryza sativa (AK066373) and N . tabacum (AB193039). Based on the alignment of nucleotide sequences of these homologues, we designed degenerate primers TOM1F and TOM1R. A 0.6 kb cDNA fragment was PCR-amplified with these primers from N . benthamiana . Sequence analysis and comparison revealed that the fragment (AM261863, named as NbTOM1 gene) was closely related to AtTOM1 homologues of N . tabacum and L . esculentum with 97.2% and 92.6% nucleotide sequence identities, respectively (Table 1 1 ). NbTOM1 NtTOM1 LeTOM1 AtTOM1 OsTPM1 NbTOM1 − 97.4 94.3 81.3 74.1 NtTOM1 97.2 − 93.8 77.4 71.9 LeTOM1 92.6 80.3 − 76.0 71.2 AtTOM1 69.5 59.0 52.5 − 71.8 OsTPM1 63.9 80.3 47.2 49.9 − To investigate whether NbTOM1 supports TMV multiplication, we tried to inhibit the expression of NbTOM1 by virus induced gene silencing (VIGS). For this purpose, the NbTOM1 fragment were introduced into the TYLCCNV DNAβ-based gene silencing vector (Tao and Zhou, 2004 2004 ) to generate DNAmβ:NbTOM1. N . benthamiana plants were then co-agroinoculated with TYLCCNV and DNAmβ: NbTOM1, TYLCCNV and DNAmβ empty vector or water. Approximately 15 d after co-agroinoculation, plants were challenge-inoculated with the TMV:GFP. Within 3 weeks after challenge-inoculation, all the six tested plants that were co-agroinoculated with TYLCCNV and DNAmβ:NbTOM1 yielded a red signal under UV (Fig. 1a 1a ), due to non-proliferation of the TMV:GFP clone. In contrast, the control plants yielded a green signal due to the GFP expression accompanying TMV multiplication (Figs. 1b and 1c 1b and 1c ). When NbTOM1 -silenced N . benthamiana plants were challenge-inoculated with Cucumber mosaic virus, the inoculated plant produced severe viral symptoms similar to those in non-silenced control plants (data not shown). These results suggest that the multiplication of TMV is inhibited in the NbTOM1 silenced plants. To assay the mRNA levels from the endogenous NbTOM1 gene, we performed semi-quantitative RT-PCR. The results obtained revealed that the level of NbTOM1 mRNA was reduced by more than 80% in the systemic NbTOM1 silenced N . benthamiana plants compared with the control plants. In contrast, the level of mRNA of EF-1-α , which served as an internal control for RNA quantity in RT-PCR amplification, was similar in NbTOM1 -silenced and the control plants (Fig. 2 2 ). These results suggest that NbTOM1 mRNA is a target of VIGS. To further monitor the level of TMV multiplication, total RNA was isolated from leaves and analyzed by Northern blot hybridization using a probe specific for TMV. Hybridization results revealed a complete inhibition of TMV multiplication in NbTOM1 silenced plants, correlating well with the results from the corresponding GFP expression assays (Fig. 3 3 ). Lanes 1 and 2 show viral RNA from NbTOM1 -non-silenced plants; Lanes 3 and 4 show viral RNA from individual NbTOM1 -silenced plants. Lower panels show RNAs stained with ethidium bromide The discovery of host factors, including proteins, membranes, and nucleic acids that are implicated in viral infection cycles is providing fundamental clues about the molecular bases of viral susceptibility. As a host factor, AtTOM1 , which is associated with the TMV-Cg replication complex, supports efficient TMV-Cg multiplication in A . thaliana (Yamanaka et al., 2000 2000 ). In this report, we characterized an AtTOM1 -like gene from N . benthamiana ( NbTOM1 ), and demonstrated that NbTOM1 plays an essential role in TMV multiplication. Our results are consistent with previous reports. We have demonstrated that the VIGS-induced knockdown of NbTOM1 confers strong TMV resistance in N . benthamiana . As AtTOM1 homologues have been reported in several kinds of plants (Asano et al., 2005 2005 ), similar strategies might be applicable to a wide range of economically important plants. Compared with conventional transgenic approaches, VIGS offers advantages for generating virus-resistant plants because it does not rely on stable plant transformants. References M Asano , R Satoh , A Mochizuki , S Tsuda , T Yamanaka , M Nishiguchi , K Hirai , T Meshi , S Naito , M Ishikawa . Tobamovirus-resistant tobacco generated by RNA interference directed against host genes . FEBS Lett , 2005 . 579 ( 20 ): 4479 - 4484 . 16081069 DOI: 10.1016/j.febslet.2005.07.021 http://doi.org/10.1016/j.febslet.2005.07.021 . Tobamovirus-resistant tobacco generated by RNA interference directed against host genes XF Cui , XR Tao , Y Xie , CM Fauquet , XP Zhou . A DNAβ associated with Tomato yellow leaf curl China virus is required for symptom induction . J Virol , 2004 . 78 ( 24 ): 13966 - 13974 . 15564504 DOI: 10.1128/JVI.78.24.13966-13974.2004 http://doi.org/10.1128/JVI.78.24.13966-13974.2004 . A DNAβ associated with Tomato yellow leaf curl China virus is required for symptom induction R Goldbach , E Bucher , M Prins . Resistance mechanisms to plant viruses: an overview . Virus Res , 2003 . 92 ( 2 ): 207 - 212 . 12686431 DOI: 10.1016/S0168-1702(02)00353-2 http://doi.org/10.1016/S0168-1702(02)00353-2 . Resistance mechanisms to plant viruses: an overview Y Hagiwara , K Komoda , T Yamanaka , A Tamai , T Meshi , R Funada , T Tsuchiya , S Naito , M Ishikawa . Subcellular localization of host and viral proteins associated with tobamovirus RNA replication . EMBO J , 2003 . 22 ( 2 ): 344 - 353 . 12514140 DOI: 10.1093/emboj/cdg033 http://doi.org/10.1093/emboj/cdg033 . Subcellular localization of host and viral proteins associated with tobamovirus RNA replication MMC Lai . Cellular factors in the transcription and replication of viral RNA genomes: a parallel to DNA-dependent RNA transcription . Virology , 1998 . 244 ( 1 ): 1 - 12 . 9581772 DOI: 10.1006/viro.1998.9098 http://doi.org/10.1006/viro.1998.9098 . Cellular factors in the transcription and replication of viral RNA genomes: a parallel to DNA-dependent RNA transcription WM Lee , M Ishikawa , P Ahlquist . Mutation of host Delta 9 fatty acid desaturase inhibits brome mosaic virus RNA replication between template recognition and RNA synthesis . J Virol , 2001 . 75 ( 5 ): 2097 - 2106 . 11160714 DOI: 10.1128/JVI.75.5.2097-2106.2001 http://doi.org/10.1128/JVI.75.5.2097-2106.2001 . Mutation of host Delta 9 fatty acid desaturase inhibits brome mosaic virus RNA replication between template recognition and RNA synthesis AO Noueiry , JB Chen , P Ahlquist . A mutant allele of essential, general translation initiation factor DED1 selectively inhibits translation of a viral mRNA . Proc Natl Acad Sci USA , 2000 . 97 ( 24 ): 12985 - 12990 . DOI: 10.1073/pnas.240460897 http://doi.org/10.1073/pnas.240460897 . A mutant allele of essential, general translation initiation factor DED1 selectively inhibits translation of a viral mRNA XR Tao , XP Zhou . A modified viral satellite DNA that suppresses gene expression in plant . Plant J , 2004 . 38 ( 5 ): 850 - 860 . 15144385 DOI: 10.1111/j.1365-313X.2004.02087.x http://doi.org/10.1111/j.1365-313X.2004.02087.x . A modified viral satellite DNA that suppresses gene expression in plant T Yamanaka , T Ohta , M Takahashi , 等 . TOM1, an Arabidopsis gene required for efficient multiplication of a tobamovirus, encodes a putative transmembrane protein . Proc Natl Acad Sci USA , 2000 . 97 ( 18 ): 10107 - 10112 . DOI: 10.1073/pnas.170295097 http://doi.org/10.1073/pnas.170295097 . TOM1, an Arabidopsis gene required for efficient multiplication of a tobamovirus, encodes a putative transmembrane protein T Yamanaka , T Imai , R Satoh , A Kawashima , M Takahashi , K Tomita , K Kubota , T Meshi , S Naito , M Ishikawa . Complete inhibition of tobamovirus multiplication by simultaneous mutations in two homologous host genes . J Virol , 2002 . 76 ( 5 ): 2491 - 2497 . 11836427 DOI: 10.1128/jvi.76.5.2491-2497.2002 http://doi.org/10.1128/jvi.76.5.2491-2497.2002 . Complete inhibition of tobamovirus multiplication by simultaneous mutations in two homologous host genes K Zhang , YB Niu , XP Zhou . Transgenic tobacco plants expressing dsRNA can prevent infection by Tobacco mosaic virus . Chin J Agric Biotechnol , 2005 . 2 ( 3 ): 201 - 205 . DOI: 10.1079/CJB200578 http://doi.org/10.1079/CJB200578 . Transgenic tobacco plants expressing dsRNA can prevent infection by Tobacco mosaic virus XP Zhou , Y Xie , XR Tao , ZK Zhang , ZH Li , CM Fauquet . Characterization of DNAβ associated with begomoviruses in China and evidence for co-evolution with their cognate viral DNA-A . J Gen Virol , 2003 . 84 ( 1 ): 237 - 247 . 12533720 DOI: 10.1099/vir.0.18608-0 http://doi.org/10.1099/vir.0.18608-0 . Characterization of DNAβ associated with begomoviruses in China and evidence for co-evolution with their cognate viral DNA-A 10.1631/jzus.2007.B0256 Project supported by the Cultivation Fund of the Key Scientific and Technical Innovation Project, Ministry of Education of China (No. 705025) and the National Natural Science Foundation of China (No. 30530520) 2006-09-17 2006-11-18 2022-01-05 Copyright © 2007, Journal of Zhejiang University Science 2007 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 04 08