Species-specific SCAR markers for authentication of Sinocalycanthus chinensis

Species-specific SCAR markers for authentication of Sinocalycanthus chinensis 1 first-author 1 1 2 2 2 1 corresp ‡Corresponding Author ‡Corresponding Author †E-mail:cxfu@zju.edu.cn †E-mail:cxfu@zju.edu.cn cxfu@zju.edu.cn Laboratory of Systematic and Evolutionary Botany and Biodiversity, School of Life Sciences, Zhejiang University, Hangzhou 310029, China Laboratory of Systematic and Evolutionary Botany and Biodiversity, School of Life Sciences, Zhejiang University, Hangzhou 310029, China Management Bureau of Tianmushan National Nature Conservative Area, Lin’an 311311, China Management Bureau of Tianmushan National Nature Conservative Area, Lin’an 311311, China Sinocalycanthus chinensis , an endangered species endemic to China, is cultivated as an ornamental landscape tree in China. However, S . chinensis , Chimonanthus species and Calycanthus floridus are difficult to be distinguished in seedling market because of their similar morphological characters. In this study, ISSR (inter-simple sequence repeats) were applied to detect S . chinensis from its closely related species. A unique 748-bp band was found in all accessions of S . chinensis . SCAR (sequence characterized amplified regions) markers were created by cloning and sequencing the specific band, and designing a pair of primers to amplify the band of 748 bp. Diagnostic PCRs were performed using the primer pair with the total DNAs of S . chinensis , Chimonanthus species and C . floridus as templates, with only S . chinensis being able to be amplified. This amplification is not only rapid (results can be obtained in less than 3 h), but is also easy to perform. Hence it is a feasible method for identifying S . chinensis in seedling market. Authentication Diagnostic PCRs ISSR SCAR Sinocalycanthus chinensis Specie-specific INTRODUCTION 1 Calycanthaceae consists of three genera: Calycanthus , Chimonanthus and Sinocalycanthus . Chimonanthus and Sinocalycanthus are restricted to China, and Calycanthus is distributed in North America (Zhang and Liu, 1998 1998 ). Sinocalycanthus chinensis Cheng et S.Y. Chang, the only representative in the genus Sinocalycanthus , is a deciduous shrub endemic to China. Both biological and anthropological causes have led to the recent decline of the species, which is now known from only two extant natural populations (Table 1 1 ). In China, S . chinensis is classified as second-grade protected wild plants in the Chinese Plant Red Book (Fu, 1992 1992 ). Asterisk indicates wild populations of S . chinensis ; n : number of specimens tested Species Sources of materials Sampling code ( n ) 8 Sinocalycanthus chinensis Cheng et S.Y. Chang Hangzhou Botanical Garden, Zhejiang X1 (4) Botanical Garden, Zhejiang University X2 (2) Mt. Tianmu, Natural Conservation Area, Zhejiang X3 (5) Kunming Institute of Botany, CAS, Yunnan X4 (1) ★ Lingli, Mt. Tiantai, Zhejiang X5 (3) ★ Jinguping, Mt. Tiantai, Zhejiang X6 (3) ★ Mt. Qingliangfeng, Lin’an, Zhejiang X7 (5) ★ Shunxi, Lin’an, Zhejiang X8 (4) Chimonanthus praecox (Linn.) Link Hangzhou Botanical Garden, Zhejiang 1 (3) Ch . praecox var. grandiflorus (Lindley) Makino Hangzhou Botanical Garden, Zhejiang 2 (2) Ch . praecox var. intermedius Makino Hangzhou Botanical Garden, Zhejiang 3 (2) Ch . salicifolius S.Y. Hu Hangzhou Botanical Garden, Zhejiang 4 (4) Ch . zhejiangensis M.C. Liu Hangzhou Botanical Garden, Zhejiang 5 (3) Ch . campanulatus R.H. Chang et C.S. Ding Hangzhou Botanical Garden, Zhejiang 6 (5) Calycanthus floridus Linn . Raleigh, North Carolina, USA 7 (1) C . floridus Linn. Hangzhou Botanical Garden, Zhejiang 8 (3) C . floridus var. oblongifolius (Nuttall) Boufford et Spongberg Hangzhou Botanical Garden, Zhejiang 9 (2) Although S . chinensis has very few wild populations, it is now cultivated as an ornamental landscape tree in China due to its high ornamental value with enjoyable white flowers in early summer, with the demand for S . chinensis being increased recently. But for a long period, the identification of this species relies on morphological characteristics. The insufficient ways of visual inspection (Bandana and Mahipal, 2003 2003 ) tend to cause mistakes, especially when dealing with the vegetative part of similar species or seedlings. This situation exists in S . chinensis seedling market, where some Chimonanthus species were sometimes mistakenly identified as S . chinensis during seedling period, due to morphological similarity. Therefore, it is necessary and urgent to provide an efficient and scientific authenticating method to identify S . chinensis from its related species. SCAR (sequence characterized amplified regions) markers are developed with a pair of longer primers (usually the extended sequence of a RAPD (random amplified polymorphic DNA) primer) that has a specific sequence of approximately 20 bases. Compared with universal primers, unique primers for special regions prevent site-competition among primers, and make the results less sensitive to reaction conditions and more reproducible by increasing the specificity (Hernández et al., 1999 1999 ). Reliable SCAR markers have already been successfully derived from RAPD fragments in Lettuca , Triticum , and Agrostis (Paran and Michelmore, 1993 1993 ; Hernández et al., 1999 1999 ; Elizabeth et al., 2003 2003 ). ISSR (inter-simple sequence repeats) are presented to detect differences between SSRs (simple sequence repeats) (Zietkiewicz et al., 1994 1994 ). No sequence information is required prior to analysis, and only a minute amount of DNA is needed (Welsh and McClelland, 1990 1990 ; Williams et al., 1990 1990 ). Compared with the low fidelity of RAPD in some circumstances (Micheli et al., 1994 1994 ), the longer primers and higher annealing temperature of ISSR can provide more reproducibility and stability (Esselman et al., 1999 1999 ; Camacho and Liston, 2001 2001 ; Zou et al., 2001 2001 ). Here we use ISSR (inter-simple sequence repeats) method to detect specific fragments among sample species, and converse the ISSR fragments into SCAR markers. Stable specific SCAR markers can help us to distinguish S . chinensis individuals from its closely related species. MATERIALS AND METHODS 1 Plant materials and DNA extraction 2 Fresh leaves of S . chinensis and its closely related species were sampled from natural populations and introduced populations (Table 1 1 ). Species of Parakmeria lotungensis (Chun et Txoong) La, Illicium henryi Diels and Chloranthus henryi Hemsley were also selected as contrast species. Two to five individuals of each species were tested, except C . floridus Linn. with only one specimen. Genomic DNA was extracted using the modified CTAB (hexadecyltrinethyl-ammoniu bromide) method (Doyle, 1991 1991 ). DNA concentration for all samples was estimated using a DNA ladder of known concentration and a spectrophotometer at 260 and 280 nm. Working stocks of DNA were then prepared based on both estimates. Total DNA was solvated in 0.1×TE for further use. ISSR-PCR amplification 2 Fifty-two primers (UBC primer set No. 9, Biotechnology Laboratory, University of British Columbia, Vancouver, Canada, http://www.ubc.ca/ http://www.ubc.ca/ ) were screened initially to identify well amplified (polymerase provided by Shanghai Sangon Biotechnology Co. Ltd., Shanghai, China), polymorphic bands against all plants used in this study. Out of 52 primers tested, eleven primers, which gave the strongest, clearest and most reproducible bands, were then chosen for further study (Table 2 2 ). PCR reaction mix (25 μl) contained 60 ng template DNA, 1.2 U of Taq DNA polymerase, 1.5 mmol/L MgCl 2 , 0.25 mmol/L each of dATP, dTTP, dCTP, and dGTP, 0.4 μmol/L primer. Amplification was performed in a thermal cycler (GeneAmp® PCR System 9700, Applied Biosystems, Foster City, USA) with profile: 94 °C, 5 min; 45 cycles of 94 °C 1 min, 52 °C 45 s and 72 °C 2 min; 72 °C, 5 min. A negative contrast with no DNA was included in each PCR run. The amplification was repeated at least twice. PCR products were separated according to size on 1.5% agarose gels in a 0.5×TBE buffer, stained with ethidium bromide (0.5 μg/ml), visualized with ultraviolet light and photographed. DNA Marker DL2000 (TaKaRa Biotechnology Co. Ltd., Dalian, China) was used. Primer code Sequence (5′~3′) UBC 807 (AG) 8 T UBC 811 (GA) 8 C UBC 817 (CA) 8 A UBC 818 (CA) 8 G UBC 825 (AC) 8 T UBC 842 (GA) 8 CG UBC 852 (TC) 8 GA UBC 854 (TC) 8 AG UBC 857 (AC) 8 GG UBC 879 CTT CAC TTC ACT TCA UBC 880 GGA GAG GAG AGG AGA Cloning and sequencing of specific ISSR fragments 2 The desired band only amplified in S . chinensis was excised from agarose gel, purified by GENECLEAN II Kit (BIO 101, Inc. Carlsbad, USA) according to the manufacturer’s protocols, and cloned into PUCm-T vector (Sangon, Shanghai, China). Sequencing of the cloned PCR product was carried out with BigDye Terminator-Sequencing kit (Perkin-Elmer, Inc. Norfolk, Connecticut, USA). Resulting sequence was edited by using SEQUENCHER software (v. 4.0.5 Gene Codes Corporation, Ann Arbor, MI, USA). Primer design and SCAR-PCR 2 Specific primers were designed from the sequence of the specific DNA fragments using Oligo 6.0 (Molecular Biology Insights, Inc. Cascade, CO, USA), and synthesized by Sangon of Shanghai. SCAR-PCR amplification was performed with the same reaction mixture (containing 0.2 μmol/L of the upper and lower primer), in the same thermal cycler as described above, using a cycle of 5 min at 94 °C; 45 cycles of 1 min at 94 °C, 45 s at 65 °C, 30 s at 72 °C; and 1 cycle of 5 min at 72 °C. Amplification products were resolved electrophoretically by 1.5% TBE agarose gels and proved to be 748 bp. RESULTS 1 Screening the specific ISSR marker 2 Seventeen accessions consisting of 6 species and 4 varieties (Table 1 1 ) were chosen to develop species-specific SCAR markers of S . chinensis . After ISSR-PCRs for screening against the DNAs of the 17 accessions, we found that the bright, consistent and specific band existed only in S . chinensis accessions. As seen in Fig. 1 1 , ISSR primer UBC 811 provided an approximately 750-bp band unique to the species. The species-specific band could be obtained in both wild populations and introduced populations of the species, and was selected for conversion into species-specific SCAR markers. Lanes: M: Weight marker (bp); 1: Ch . praecox ; 2: Ch . praecox var. grandiflorus ; 3: Ch . praecox var. intermedius ; 4: Ch . salicifolius ; 5: Ch . zhejiangensis ; 6: Ch . campanulatus ; 7: C . floridus ; 8: C . floridus var. floridus ; X1: S . chinensis Conversion of ISSR marker into SCARs 2 The approximately 750-bp band amplified from 8 accessions of S . chinensis was cloned and sequenced to obtain a 748-bp sequence (GenBank accession number: bankit755109 DQ321501). It was noted that the first and the last seventeen bases of the 748-bp sequence corresponded to the initial sequence of UBC 811 primer. A pair of 25-bp SCAR primers was designed from the sequence (Table 3 3 ), with the best places of the upper primer being 28 bp from 5′ of the sequence, and the lower primer being 25 bp from 3′ of the sequence. Due to consideration to reduce the secondary structure between primers, the SCAR primer pair contained no bases of the UBC 811 primer. The reaction system and PCR conditions of diagnostic PCR are described in materials and methods. The annealing temperature was tested from 60 °C to 65 °C, with the best annealing temperature of these species-specific primers determined to be 65 °C. The SCAR primer pair was named ZJUFY01/ZJUFY02 (Table 3 3 ). ISSR primer SCAR primer 5′~3′ sequence Annealing temperature (°C) 2 UBC 811 ZJUFY01 CATCATATACATTGTCAGGTGCTAC 2 65 ZJUFY02 GTCCCATATTCAACTGTGTTAAAGT Testing designed SCAR primers 2 The SCAR primer pair was then used to amplify sample DNAs listed in Table 1 1 . The 748-bp fragment was only amplified in all accessions of S . chinensis (Fig. 2 2 ). Besides, ZJUFY01 and ZJUFY02 were also tested with three species from close families of S . chinensis (namely P . lotungensis , I . henryi , and C . henryi ), but produced nothing (Fig. 2 2 ). A bright, unique and easily identifiable band could be observed in the banding patterns of all S . chinensis individuals collected from different localities, whereas no band was found in any other related species, genera and families (Fig. 2 2 ). So that the SCAR primer pair (ZJUFY01/ZJUFY02) designed in this study proved to be a species-specific marker of S . chinensis . Lanes: M: Weight marker (bp); 1: Ch . praecox ; 2: Ch . praecox var. grandiflorus ; 3: Ch . praecox var. intermedius ; 4: Ch . salicifolius ; 5: Ch . zhejiangensis ; 6: Ch . campanulatus ; 7: C . floridus ; 8: C . floridus var. floridus ; 9: C . floridus var. oblongifolius ; Le: P . lotungensis ; H: I . henryi ; K: C . henryi ; X1-X8: S . chinensis : X1: Hangzhou Botanical Garden; X2: Botanical Garden, Zhejiang Univ.; X3: Mt. Tianmu, Natural Conservation Area, Zhejiang; X4: Kunming Institute of Botany, CAS, Yunnan; X5: Lingli, Mt. Tiantai, Zhejiang; X6: Jinguping, Mt. Tiantai, Zhejiang; X7: Mt. Qingliangfeng, Lin’an, Zhejiang; X8: Shunxi, Lin’an, Zhejiang DISCUSSION AND CONCLUSION 1 S . chinensis has been studied extensively in China because it is an endangered species of high ornamental value, and is also a traditional Chinese herbal medicine. The molecular method we reported here is confirmed to be a credible and convenient solution for identifying S . chinensis , other than morphological method, especially during seedling period. A minute amount of genomic DNA is needed. DNA quality is not as important as in RAPD fingerprinting analysis. The longer length (25 bp) and higher temperature (65 °C) of SCAR primers make the reaction more specific, reproducible and stable. Therefore, the work we did here proved SCAR marker to be an efficient and available way for S . chinensis species identification. It also throws light on the authentication of Chinese herbal medicine. Besides, we hope the information here would contribute to the conservation of the endangered species. References D Bandana , S Mahipal . Molecular detection of cashew husk ( Anacardium occidentale ) adulteration in market samples of dry tea ( Camellia sinensis ) . Planta Med , 2003 . 69 ( 9 ): 882 - 884 . 14598225 DOI: 10.1055/s-2003-43211 http://doi.org/10.1055/s-2003-43211 . Molecular detection of cashew husk (Anacardium occidentale) adulteration in market samples of dry tea (Camellia sinensis) FJ Camacho , A Liston . Population structure and genetic diversity of Botrychium pumicola (Ophioglossaceae) based on ISSR . Am J Bot , 2001 . 88 ( 6 ): 1065 - 1070 . 11410471 . Population structure and genetic diversity of Botrychium pumicola (Ophioglossaceae) based on ISSR JJ Doyle . GM Hewitt , A Johnston . DNA Protocols for Plants—CTAB Total DNA Isolation . Molecular Techniques in Taxonomy , 1991 . : Berlin, Germany Springer-Verlag , 283 - 293 . . DNA Protocols for Plants—CTAB Total DNA Isolation AS Elizabeth , DC Michael , J Geunhwa . Development of species-specific SCAR markers in Bentgrass . Crop Sci , 2003 . 43 345 - 349 . . Development of species-specific SCAR markers in Bentgrass EJ Esselman , JQ Li , DJ Crawford , JL Windus , AD Wolfe . Clonal diversity in the rare Calamagrostis porteri ssp. insperata (Placeae): comparative results for allozymes and random amplified polymorphic DNA (RAPD) and intersimple sequence repeat (ISSR) markers . Mol Ecol , 1999 . 8 ( 3 ): 443 - 443 . DOI: 10.1046/j.1365-294X.1999.00585.x http://doi.org/10.1046/j.1365-294X.1999.00585.x . Clonal diversity in the rare Calamagrostis porteri ssp. insperata (Placeae): comparative results for allozymes and random amplified polymorphic DNA (RAPD) and intersimple sequence repeat (ISSR) markers LG Fu . Chinese Plant Red Book , 1992 . : Beijing Science Press , (in Chinese) . Chinese Plant Red Book P Hernández , A Martin , G Dorado . Development of SCARs by direct sequencing of RAPD products: a practical tool for the introgression and marker-assisted selection of wheat . Mol Breed , 1999 . 5 ( 3 ): 245 - 253 . DOI: 10.1023/A:1009637928471 http://doi.org/10.1023/A:1009637928471 . Development of SCARs by direct sequencing of RAPD products: a practical tool for the introgression and marker-assisted selection of wheat MR Micheli , R Bova , E Pascale , E D′Ambrosio . Reproducible DNA fingerprint with the random amplified polymorphic DNA (RAPD) method . Nucl Acids Res , 1994 . 22 1921 - 1922 . 8208620 . Reproducible DNA fingerprint with the random amplified polymorphic DNA (RAPD) method I Paran , RW Michelmore . Development of reliable PCR-based markers linked to downy mildew resistance genes in lettuce . Theor Appl Genet , 1993 . 85 ( 8 ): 985 - 993 . DOI: 10.1007/BF00215038 http://doi.org/10.1007/BF00215038 . Development of reliable PCR-based markers linked to downy mildew resistance genes in lettuce J Welsh , M McClelland . Fingerprinting genomes using PCR with arbitrary primers . Nucl Acids Res , 1990 . 18 7213 - 7218 . 2259619 . Fingerprinting genomes using PCR with arbitrary primers JGK Williams , AR Kubelik , KJ Livak , JA Rafalski , S Tingey . DNA polymorphisms amplified by arbitrary primers are useful as genetic markers . Nucl Acids Res , 1990 . 18 6531 - 6535 . 1979162 . DNA polymorphisms amplified by arbitrary primers are useful as genetic markers RH Zhang , HE Liu . Wax Shrubs in World (Calycanthaceae) , 1998 . : Beijing, China China Science and Technology Press , (in Chinese) . Wax Shrubs in World (Calycanthaceae) E Zietkiewicz , A Rafalski , D Labuda . Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification . Genomics , 1994 . 20 ( 2 ): 176 - 183 . 8020964 DOI: 10.1006/geno.1994.1151 http://doi.org/10.1006/geno.1994.1151 . Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification YP Zou , S Ge , XD Wang . Molecular Markers in Systemic and Evolutionary Botany , 2001 . : Beijing, China Science Press , (in Chinese) . Molecular Markers in Systemic and Evolutionary Botany The authors are grateful to Mr. Hu Shaoqing (Hangzhou Botanical Garden of Zhejiang, China) for assistance in collection of specimens. 10.1631/jzus.2006.B0868 Project (No. G2000046806) supported by the National Basic Research Program (973) of China 2005-10-08 2006-05-10 2006-10-17 2022-01-05 Copyright © 2006, Journal of Zhejiang University Science 2006 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 11 07