A new genetic factor for root gravitropism in rice (Oryza sativa L.)

A new genetic factor for root gravitropism in rice ( Oryza sativa L.) first-author †E-mail:jhshi@zju.edu.cn †E-mail:jhshi@zju.edu.cn jhshi@zju.edu.cn State Key Laboratory of Plant Physiology and Biochemistry, College of Life Sciences, Zhejiang University, Hangzhou 310058, China State Key Laboratory of Plant Physiology and Biochemistry, College of Life Sciences, Zhejiang University, Hangzhou 310058, China Root gravitropism is one of the important factors to determine root architecture. To understand the mechanism underlying root gravitropism, we isolated a rice (Xiushui63) mutant defective in root gravitropism, designated as gls1 . Vertical sections of root caps revealed that gls1 mutant displayed normal distribution of amyloplast in the columella cells compared with the wild type. The gls1 mutant was less sensitive to 2,4-dichlorophenoxyacetic acid (2,4-D) and α-naphthaleneacetic acid (NAA) than the wild type. Genetic analysis indicated that the phenotype of gls1 mutant was caused by a single recessive mutation, which is mapped in a 255-kb region between RM16253 and CAPS1 on the short arm of chromosome 4. Oryza sativa L. Root gravitropism Genetic factor INTRODUCTION 1 Rice is an important food crop in the world. Rice root system is mainly composed of primary, adventitious, and lateral roots, which play vital roles in acquiring water and nutrients and in anchoring plants in the soil. Root gravitropism is one of the important factors to determine root architecture, and root gravitropic sensitivity affects spatial distribution of root system in the soil and consequently the nutrient uptake efficiency (Lynch, 1995 1995 ; Rubio et al., 2001 2001 ). The Cholodny-Went theory proposes that lateral auxin transport and its asymmetrical redistribution across organs upon gravistimulation are essential for normal gravitropic curvature responses (Chen et al., 2002 2002 ; Blancaflor and Masson, 2003 2003 ; Perrin et al., 2005 2005 ; Harrison and Masson, 2008 2008 ). Yet the mechanisms that mediate gravity perception in plants remain poorly understood. The starch-statolith hypothesis postulates that gravity perception in plants is mediated by the sedimentation or pressure/tension exerted by starch-filled statoliths within the gravity-perceiving columella cells in the root caps and the endodermal starch sheath cells in shoots (Morita and Tasaka, 2004 2004 ; Stanga et al., 2009 2009 ). Numerous studies have shown that amyloplasts are important in gravity perception. Starch deficient pgm1 mutant lacks a normal response to gravistimulation compared with the wild type (WT) (Caspar and Pickard, 1989 1989 ; Kiss et al., 1989 1989 ), and mutants with intermediate levels of starch are more gravisensitive than starchless mutants but are less sensitive than the WT (Kiss et al., 1997 1997 ), while the starch excess mutant sex1 displays an increased sensitivity to gravistimulation (Vitha et al., 2007 2007 ). Until now, there has been no definitive description of the mechanism that senses the position or movement of amyloplasts within the statocytes (Perrin et al., 2005 2005 ). The cytoskeleton is proposed to interact with the sedimenting amyloplasts in the processes of gravity perception and signal transduction (Baluška and Hasenstein, 1997 1997 ). It has been proposed that sedimenting amyloplasts may activate mechano-sensitive ion channels at the plasma membrane or the endoplasmic reticulum by sedimentation onto them, by exerting pressure on the actin cytoskeleton, or by disrupting dense actin network (Harrison and Masson, 2008 2008 ). Auxin regulates a variety of growth and development processes, including cell elongation, cell division, lateral root formation, and tropic responses (Hobbie, 1998 1998 ). In Arabidopsis many auxin signal related mutants, such as axr1 (Lincoln et al., 1990 1990 ), axr2 (Wilson et al., 1990 1990 ), axr3 (Leyser et al., 1996 1996 ), axr4 (Hobbie and Estelle, 1995 1995 ), axr5 (Yang et al., 2004 2004 ), and axr6 (Hobbie et al., 2000 2000 ), display pleiotropic phenotypic defects, including decreased lateral root number, agravitropic response, and suppressed root inhibition, providing the evidences that auxin plays a pivotal role in these processes. In rice, auxin resistant mutants lrt1 (Hao and Ichii, 1999 1999 ) and lrt2 (Wang et al., 2006 2006 ) were isolated, and both mutants showed defects in lateral root formation and altered root gravitropic response, suggesting that auxin is required for normal root growth. In this study, we isolated and characterized a rice mutant defective in root gravitropism, designated gls1 ( gravitropism loss 1 ). The gls1 mutant displayed decreased sensitivity to auxin. We mapped GLS1 using both simple sequence repeats (SSRs) and cleaved amplified polymorphic sequence (CAPS) markers. MATERIALS AND METHODS 1 Plant growth conditions and mutant isolation 2 Hydroponic culture was carried out using rice ( Oryza sativa L.) culture solution (Yoshida et al., 1976 1976 ). Paper pouch culture was conducted using blue no-phosphorus paper enclosed by plastic bag filled with 100 ml rice culture solution, the germinated seeds were transferred onto the paper after sterilization, and the bags were hanged vertically in the growth chamber. Phenotypic characterization of the WT and mutant was performed in a growth chamber at 30/22 °C (day/night) and 60%~70% humidity under a photoperiod of 12 h. The gls1 mutant was isolated from an ethyl methane sulfonate (EMS)-generated rice mutant library ( Oryza sativa L. japonica cv. Xiushui63) under rice culture solution. On Day 4, plants defective in root gravitropism were transferred to the soil. Progeny was then re-tested under the same conditions. Microscopic analysis 2 For microscopic analysis of amyloplast sedimentation, the gls1 and WT seedlings were cultivated for 6 d in nutrient solution, then kept vertical in solution (for control) or horizontally placed (for gravistimulation) in plastic net floating in culture solution for 1 h. Root tips from vertically and horizontally grown plants were fixed overnight at 4 °C in 2.5% (v/v) glutaraldehyde in 0.1 mol/L sodium phosphate buffer (pH 7.2) and then washed three times for 30 min in the same buffer. Root samples were then postfixed in osmium tetroxide (OsO 4 ) for 4 h at room temperature and washed for 30 min in the same buffer. Samples were dehydrated through a gradient ethanol (30%, 50%, 70%, 80%, 90%, 95% (v/v) and three changes of 100% ethanol) for 30 min each, and then infiltrated through ethanol. The samples were embedded in pure Spurr resin, and polymerized overnight at 70 °C. Semithin sections (2 μm thick) were made using glass knives on a power Tome XL microtome (RMC-Boeckeler Instruments, Tucson, AZ, USA) and stained with 0.1% (w/v) methylene blue for 3~5 min at 70 °C. The samples were rinsed with distilled water and visualized with a Zeiss Axiovert 200 microscope with a color charge-coupled device camera (Zeiss, Jena, Germany) (Jia et al., 2008 2008 ). Exogenous auxin and 1- N -naphthylphthalamic acid treatments 2 The gls1 and WT seeds were germinated in distilled water, and placed in plastic net floating in rice culture solution (α-naphthaleneacetic acid (NAA) at 0.01 μmol/L or 0.1 μmol/L, 2,4-dichlorophenoxy-acetic acid (2,4-D) at 0.01 μmol/L or 0.1 μmol/L, 1- N -naphthylphthalamic (NPA) at 0.5 μmol/L). The seedlings were sampled on Day 10 after germination for NAA and 2,4-D treatments. On Day 7 after germination for the NPA treatment, primary root length and shoot height were measured by counter ruler, and lateral root length and number were analyzed using a scanner connected to an image-analysis system WinRHIZO (Regent, Canada). Phenotypic analysis of gls1 mutant and mapping of GLS1 gene 2 The root tips and surfaces were examined and photographed using a Leica MZ95 stereomicroscope with a color charge coupled device (CCD) camera. Root lengths and numbers were analyzed as described as above. For genetic analysis and mapping, gls1 mutant was crossed with Kasalath ( Oryza sativa L. indica cv. Kasalath; WT seeds provided by International Rice Research Institute (IRRI)), and F2 progenies showing gls1 mutant phenotype were selected. GLS1 gene was mapped with SSRs and CAPS markers using 265 F 2 mutant plants. RESULTS 1 Isolation and characterization of gls1 mutant 2 Seeds from the M2 generation of an ethyl methane sulfonate-mutagenized population of rice (Xiushui63) were germinated and grown in rice nutrient solution (Yoshida et al., 1976 1976 ) to screen mutants with abnormal root development. A rice mutant defective in root gravitropism on Day 4 after germination was isolated and designated as gls1 . Under paper pouch culture, gls1 mutant led to a loss of root gravitropism on Day 10 after germination (Fig. 1a 1a ). Under nutrient solution culture, the gls1 mutant exhibited impaired primary root gravitropism on Day 4 (Fig. 1b 1b ) and loss of gravitropism of the whole root system on Day 40 (Fig. 1c 1c ). Bar=2 cm Under paper pouch culture for 10 d, the primary root length and the shoot height of the mutant were about 61% and 81.5% of those of the WT, respectively. Average lateral root length of the mutant was 0.6 times longer than that of the WT (Table 1 1 ). No significant ( P > 0.05) differences between the mutant and the WT plants were observed in adventitious root number, average adventitious root length, or lateral root number evaluated (Table 1 1 ). Data represent the mean±SE of 5 plants in each line. AR and LR stand for adventitious root and lateral root, respectively. Asterisks indicate significant differences between gls1 mutant and the WT P < 0.05, Student’s t -test Plant Primary root length (cm) Shoot height (cm) Adventitious root No. Average AR length (cm) Lateral root No. Average LR length (cm) WT 20.56±1.40 9.28±0.16 4.20±0.86 6.74±0.34 225.60±18.80 0.14±0.02 gls1 12.54±2.46 * * 7.56±0.35 * * 4.40±0.25 7.22±0.45 213.40±25.09 0.22±0.03 * * Sedimentation of amyloplasts was analyzed at a cellular level for the WT and the gls1 mutant. Vertical sections from root tips of 6-d-old seedlings grown in nutrient solution indicated that the sedimentation of amyloplasts in response to gravity in the mutant root cap was similar to that in the WT without gravistimulation (Figs. 2e~2h 2e~2h ), and with the treatment of 1-h gravistimulation, the gls1 mutant showed normal amyloplast sedimentation in the columella cells compared with the WT (Figs. 2a~2d 2a~2d ). We therefore concluded that amyloplasts in root cap of the gls1 mutant could normally sediment toward the direction of gravity vector compared with those in the WT, although we cannot yet exclude the possibility that the mutation affects the rate of amyloplast sedimentation relative to the WT. Bar=50 μm; The arrows show the direction of gravity vector (G) Auxin responses of gls1 mutant 2 To examine the effect of exogenous auxin on the gls1 mutant root growth, seeds of the WT and the gls1 mutant were germinated and grown in nutrient solution supplied with different concentrations of synthetic auxin analogue, NAA and 2,4-D. Treatments with 0.01 and 0.1 μmol/L NAA significantly decreased the length of primary root in both WT and gls1 mutant, but the gls1 mutant was less sensitive than the WT. At 0.01 μmol/L NAA, the primary root lengths of the WT and the gls1 mutant were decreased by 22% and 7.9%, respectively. At 0.1 μmol/L NAA, the primary root lengths of the WT and the gls1 mutant were decreased by 73.2% and 51.1%, respectively (Figs. 3a~3d 3a~3d ). Treatments with 0.01 and 0.1 μmol/L NAA also significantly decreased lateral root numbers in both WT and gls1 mutant. At 0.01 μmol/L NAA, the lateral root numbers of the WT and the gls1 mutant were decreased by 31.5% and 15.9%, respectively, whereas at 0.1 μmol/L NAA, the lateral root numbers of WT and gls1 were decreased by 61.1% and 30.8%, respectively (Figs. 3g and 3h 3g and 3h ). The values of 5 seedlings were averaged; Asterisks indicate significant differences between the gls1 mutant and the WT at various treatments ( * P < 0.05, Student’s t -test); Bar=2 cm Treatments with 0.01 and 0.1 μmol/L 2,4-D significantly decreased the primary root length in both the WT and gls1 mutant. At 0.01 μmol/L 2,4-D, the primary root lengths of the WT and the gls1 mutant were decreased by 44.3% and 34.7%, respectively, and at 0.1 μmol/L 2,4-D, the primary root lengths of the WT and the gls1 mutant were decreased by 79.9% and 67.5%, respectively (Figs. 3a, 3b 3a, 3b , 3e and 3f 3e and 3f ). Treatments with 0.01 and 0.1 μmol/L 2,4-D also significantly decreased the lateral root number in both the WT and gls1 mutant. At 0.01 μmol/L 2,4-D, the lateral root numbers of the WT and the gls1 mutant were decreased by 89.9% and 57.4%, respectively. At 0.1 μmol/L 2,4-D, the lateral root numbers of the WT and the gls1 mutant were decreased by 93.6% and 80.3%, respectively (Figs. 3g and 3h 3g and 3h ). In addition, the response of gls1 roots to auxin transport inhibitor NPA was similar to that of the WT (Fig. 3i 3i ). Taken together, we concluded that the gls1 mutant is insensitive to auxin compared with the WT. Genetic analysis and GLS1 gene mapping 2 For genetic analysis, seeds of F 1 progeny were derived from a cross between the gls1 mutant and the indica cv. Kasalath. The F 1 seedlings showed the WT phenotype. F 2 progenies displayed a ratio of 3:1 [151:32, χ 2 =0.021 < χ 0.05 2 =3.841] segregation of the WT:mutant phenotype, suggesting that the mutant phenotype was controlled by a single recessive gene. For mapping GLS1 , we used 120 SSR markers distributed with 10~30 cM intervals on 12 chromosomes. By using 265 F 2 mutant plants, the GLS1 was mapped on chromosome 4 linked to RM16260. To further mapping, markers RM16285, RM16253, and the new generated CAPS1 (forward primer: CTAAACTGGCCTAGATCCTTTTC; reverse primer: GTAATGCATCATACAACATGA; restriction enzyme, ClaI) on the flanked region were used. The mapping result shows that the GLS1 gene was located in a 255-kb region between RM16253 and CAPS1 on the short arm of chromosome 4 (Fig. 4 4 ). There were 24 putative genes (including 2 miRNAs) and many other small RNAs ( http://sundarlab.ucdavis.edu/cgi-bin/smrnabrowse/rice2/ http://sundarlab.ucdavis.edu/cgi-bin/smrnabrowse/rice2/ ) in this 255-kb region based on the database ( http://www.tigr.org http://www.tigr.org ) (Table 2 2 ). http://www.tigr.org http://www.tigr.org BED: Drosophila BEAF and DREF related domain; MRG: human MORF4 related gene; ELMO1: the engulfment and cell motility 1 gene; PCI: proteasome-COP9-initiation factor Locus name Annotation RM16253 (63 061 bp)  LOC_Os04g01110.1 BED zinc finger family protein  LOC_Os04g01130.1 MRG family protein  LOC_Os04g01140.1 Cytochrome P450 family protein Osa-mir806f Osa-mir806h  LOC_Os04g01150.1 Phagocytosis and cell motility protein ELMO1  LOC_Os04g01160.1 Zinc ion binding, ubiquitin-protein ligase  LOC_Os04g01170.1 Unknown RM16260 (167 710 bp)  LOC_Os04g01230.1 Phosphoglycerate mutase  LOC_Os04g01240.1 Unknown  LOC_Os04g01250.1 Amidase family protein  LOC_Os04g01270.1 Unknown  LOC_Os04g01280.1 Glycosyltransferase family  LOC_Os04g01290.1 PCI domain containing, proteasome family protein  LOC_Os04g01300.1 Rhomboid protein-related contains 6 transmembrane domains  LOC_Os04g01310.1 D-mannose binding lectin family, tyrosine kinase  LOC_Os04g01320.1 D-mannose binding lectin family, tyrosine kinase  LOC_Os04g01330.1 Unknown  LOC_Os04g01354.1 Chalcone and stilbene synthases  LOC_Os04g01380.1 Unknown  LOC_Os04g01390.1 Unknown  LOC_Os04g01460.1 Unknown  LOC_Os04g01470.1 O -methyltransferase family  LOC_Os04g01480.1 Zinc finger family protein 2 CAPS1 (318 241 bp) Chr: chromosome; CAPS: cleaved amplified polymorphic sequence DISCUSSION 1 In this study, we isolated and characterized a root gls1 mutant. The gls1 mutant displays a defect in root gravity response and decreased sensitivity to auxin. The phenotype is controlled by a single recessive mutation. There is a great deal of cell biological and physiological evidence demonstrating that starch-containing amyloplasts in columella cells of the root cap are significant for gravity sensing (Chen et al., 2002 2002 ; Boonsirichai et al., 2002 2002 ). Mutants defective in starch synthesis are less sensitive to the gravity and lead to root gravitropism loss to some extent (Vitha et al., 2000 2000 ). The sedimentation of amyloplasts within the columella cells is proposed to constitute one of the initial acts of gravity sensing in roots (Chen et al., 2002 2002 ; MacCleery and Kiss, 1999 1999 ). Our results show that the differentiation of amyloplasts in columella cells of the gls1 mutant is normal compared with the WT, and that the amyloplasts can normally sediment toward the direction of gravity vector in the gls1 mutant (Figs. 2a and 2h 2a and 2h ). Therefore the sedimentation of amyloplasts in gls1 mutant cannot explain the mechanisms underlying gls1 mutant phenotype. The plant hormone auxin regulates a variety of physiological processes, including tropic responses, lateral root formation, and primary root growth (Woodward and Bartel, 2005 2005 ). NAA at 0.1 μmol/L and 2,4-D at 0.01 μmol/L significantly decreased the lateral root number and the primary root length in the WT, while the gls1 mutant is less sensitive to the two types of auxin stimuli (Figs. 3a~3f 3a~3f ). In Arabidopsis , auxin influx carrier mutant aux1 is an auxin-resistant mutant and shows aberrant root gravitropism response phenotype. The exogenously added auxin (NAA) can rescue defects in aux1 (Marchant et al., 1999 1999 ; Marchant et al., 2002 2002 ), NAA corrected the aberrant gravitropic response to the normal level, and aux1 was not resistant to NAA at all (Yamamoto and Yamamoto, 1998 1998 ). It has been reported that (NAA) treatment is able to rescue the mutated phenotypes occurring in the OsPIN1 RNAi rice plants (Xu et al., 2005 2005 ). Auxin efflux carrier mutant agr1 is involved in root gravitropism, and confers increased root growth sensitivity to auxin (Chen et al., 1998 1998 ). In Arabidopsis several auxin-resistant mutants, such as axr4 and axr6 , have been reported to display defects in root gravitropic response and lateral root development (Hobbie and Estelle, 1995 1995 ; Hobbie et al., 2000 2000 ), confirming that auxin functions in regulating root gravitropism. In our study, the gls1 mutant was insensitive to auxin compared with the WT (Figs. 3a~3h 3a~3h ), and gls1 showed the normal sensitivity to the auxin transport inhibitor NPA compared with the WT (Fig. 3i 3i ). These results suggest that gls1 mutant is involved in auxin response process. In rice, little information has been so far available on the molecular mechanisms underlying root gravitropism. The isolation and characterization of the gls1 mutant will enable us to investigate the function of the GLS1 gene and to better understand the mechanisms for auxin-mediated regulation of root gravitropism. By searching the Institute for Genomic Research (TIGR) Rice Genome Annotation Database ( http://www.tigr.org http://www.tigr.org ), we have found several candidate genes in the GLS1 locus, which are related to auxin signaling pathway (Table 2 2 ). Currently, we are conducting a high-resolution mapping of GLS1 toward its cloning and functional analysis. References F Baluška , KH Hasenstein . Root cytoskeleton: its role in perception and response to gravity . Planta , 1997 . 203 ( s1 ): S69 - S78 . 11540335 DOI: 10.1007/PL00008117 http://doi.org/10.1007/PL00008117 . Root cytoskeleton: its role in perception and response to gravity E Blancaflor , PH Masson . Plant gravitropism. Unraveling the ups and downs of a complex process . Plant Physiol , 2003 . 133 ( 4 ): 1677 - 1690 . 14681531 DOI: 10.1104/pp.103.032169 http://doi.org/10.1104/pp.103.032169 . Plant gravitropism. Unraveling the ups and downs of a complex process K Boonsirichai , C Guan , R Chen , PH Masson . Root gravitropism: an experimental tool to investigate basic cellular and molecular processes underlying mechano-sensing and signal transmission in plants . Annu Rev Plant Biol , 2002 . 53 ( 1 ): 421 - 447 . 12221983 DOI: 10.1146/annurev.arplant.53.100301.135158 http://doi.org/10.1146/annurev.arplant.53.100301.135158 . Root gravitropism: an experimental tool to investigate basic cellular and molecular processes underlying mechano-sensing and signal transmission in plants T Caspar , B Pickard . Gravitropism in a starchless mutant of Arabidopsis : implications for the starch-statolith theory of gravity sensing . Planta , 1989 . 177 ( 2 ): 185 - 197 . 11539758 DOI: 10.1007/BF00392807 http://doi.org/10.1007/BF00392807 . Gravitropism in a starchless mutant of Arabidopsis: implications for the starch-statolith theory of gravity sensing RJ Chen , P Hilson , J Sedbrook , 等 . The Arabidopsis thaliana AGRAVITROPIC1 gene encodes a component of the polar-auxin-transport efflux carrier . Proc Natl Acad Sci USA , 1998 . 95 ( 25 ): 15112 - 15117 . DOI: 10.1073/pnas.95.25.15112 http://doi.org/10.1073/pnas.95.25.15112 . The Arabidopsis thaliana AGRAVITROPIC1 gene encodes a component of the polar-auxin-transport efflux carrier RJ Chen , CH Guan , K Boonsirichai , PH Masson . Complex physiological and molecular processes underlying root gravitropism . Plant Mol Boil , 2002 . 49 ( 3/4 ): 305 - 317 . DOI: 10.1023/A:1015294711391 http://doi.org/10.1023/A:1015294711391 . Complex physiological and molecular processes underlying root gravitropism Z Hao , M Ichii . A mutant RM109 of rice ( Oryza sativa L.) exhibiting altered lateral root initiation and gravitropism . Jpn J Crop Sci , 1999 . 68 ( 2 ): 245 - 252 . . A mutant RM109 of rice (Oryza sativa L.) exhibiting altered lateral root initiation and gravitropism B Harrison , P Masson . ARL2, ARG1 and PIN3 define a gravity signal transduction pathway in root statocytes . Plant J , 2008 . 53 ( 2 ): 380 - 392 . 18047472 DOI: 10.1111/j.1365-313X.2007.03351.x http://doi.org/10.1111/j.1365-313X.2007.03351.x . ARL2, ARG1 and PIN3 define a gravity signal transduction pathway in root statocytes LJ Hobbie . Auxin: molecular genetic approaches in Arabidopsis . Plant Physiol Biochem , 1998 . 36 ( 1-2 ): 91 - 102 . DOI: 10.1016/S0981-9428(98)80094-6 http://doi.org/10.1016/S0981-9428(98)80094-6 . Auxin: molecular genetic approaches in Arabidopsis L Hobbie , M Estelle . The axr4 auxin-resistant mutants of Arabidopsis thaliana define a gene important for root gravitropism and lateral root initiation . Plant J , 1995 . 7 ( 2 ): 211 - 220 . 7704045 DOI: 10.1046/j.1365-313X.1995.7020211.x http://doi.org/10.1046/j.1365-313X.1995.7020211.x . The axr4 auxin-resistant mutants of Arabidopsis thaliana define a gene important for root gravitropism and lateral root initiation L Hobbie , M McGovern , LR Hurwitz , A Pierro , NY Liu , A Bandyopadhyay , M Estelle . The axr6 mutants of Arabidopsis thaliana define a gene involved in auxin response and early development . Development , 2000 . 127 ( 1 ): 23 - 32 . 10654597 . The axr6 mutants of Arabidopsis thaliana define a gene involved in auxin response and early development L Jia , BT Zhang , CZ Mao , JH Li , YR Wu , P Wu , ZC Wu . OsCYT-INV1 for alkaline/neutral invertase is involved in root cell development and reproductivity in rice ( Oryza sativa L.) . Planta , 2008 . 228 ( 1 ): 51 - 59 . 18317796 DOI: 10.1007/s00425-008-0718-0 http://doi.org/10.1007/s00425-008-0718-0 . OsCYT-INV1 for alkaline/neutral invertase is involved in root cell development and reproductivity in rice (Oryza sativa L.) J Kiss , R Hertel , F Sack . Amyloplasts are necessary for full gravitropic sensitivity in roots of Arabidopsis thaliana . Planta , 1989 . 177 ( 2 ): 198 - 206 . 11539759 DOI: 10.1007/BF00392808 http://doi.org/10.1007/BF00392808 . Amyloplasts are necessary for full gravitropic sensitivity in roots of Arabidopsis thaliana J Kiss , M Guisinger , A Miller , K Stackhouse . Reduced gravitropism in hypocotyls of starch-deficient mutants of Arabidopsis . Plant Cell Physiol , 1997 . 38 ( 5 ): 518 - 525 . 9210329 . Reduced gravitropism in hypocotyls of starch-deficient mutants of Arabidopsis HM Leyser , FB Pickett , S Dharmasiri , M Estelle . Mutations in the axr3 gene of Arabidopsis result in altered auxin response including ectopic expression from the SAUR-AC1 promoter . Plant J , 1996 . 10 ( 3 ): 403 - 413 . 8811856 DOI: 10.1046/j.1365-313x.1996.10030403.x http://doi.org/10.1046/j.1365-313x.1996.10030403.x . Mutations in the axr3 gene of Arabidopsis result in altered auxin response including ectopic expression from the SAUR-AC1 promoter C Lincoln , JH Britton , M Estelle . Growth and development of the axr1 mutants of Arabidopsis . Plant Cell , 1990 . 2 ( 11 ): 1071 - 1080 . 1983791 DOI: 10.1105/tpc.2.11.1071 http://doi.org/10.1105/tpc.2.11.1071 . Growth and development of the axr1 mutants of Arabidopsis J Lynch . Root architecture and plant productivity . Plant Physiol , 1995 . 109 ( 1 ): 7 - 13 . 12228579 . Root architecture and plant productivity S MacCleery , J Kiss . Plastid sedimentation kinetics in roots of wild-type and starch-deficient mutants of Arabidopsis . Plant Physiol , 1999 . 120 ( 1 ): 183 - 192 . 10318696 DOI: 10.1104/pp.120.1.183 http://doi.org/10.1104/pp.120.1.183 . Plastid sedimentation kinetics in roots of wild-type and starch-deficient mutants of Arabidopsis A Marchant , R Bhalerao , I Casimiro , J Eklof , PJ Casero , M Bennett , G Sandlberg . AUX1 promotes lateral root formation by facilitating indole-2-acetic distribution between sink and source tissues in the Arabidopsis seedlings . Plant Cell , 2002 . 14 ( 3 ): 589 - 597 . 11910006 DOI: 10.1105/tpc.010354 http://doi.org/10.1105/tpc.010354 . AUX1 promotes lateral root formation by facilitating indole-2-acetic distribution between sink and source tissues in the Arabidopsis seedlings A Marchant , J Kargul , ST May , P Muller , A Delbarre , C Perrot-Rechenmann , M Bennett . AUX1 regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues . EMBO J , 1999 . 18 ( 8 ): 2066 - 2073 . 10205161 DOI: 10.1093/emboj/18.8.2066 http://doi.org/10.1093/emboj/18.8.2066 . AUX1 regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues MT Morita , M Tasaka . Gravity sensing and signaling . Curr Opin Plant Biol , 2004 . 7 ( 6 ): 712 - 718 . 15491921 DOI: 10.1016/j.pbi.2004.09.001 http://doi.org/10.1016/j.pbi.2004.09.001 . Gravity sensing and signaling RM Perrin , LS Young , N Murthyum , BR Harrison , Y Wang , JL Will , PH Masson . Gravity signal transduction in primary roots . Ann Bot , 2005 . 96 ( 5 ): 737 - 743 . 16033778 DOI: 10.1093/aob/mci227 http://doi.org/10.1093/aob/mci227 . Gravity signal transduction in primary roots G Rubio , T Walk , ZY Ge , XL Yan , H Liao , JP Lynch . Root gravitropism and below-grown competition among neighbouring plants: a modeling approach . Ann Bot , 2001 . 88 ( 5 ): 929 - 940 . DOI: 10.1006/anbo.2001.1530 http://doi.org/10.1006/anbo.2001.1530 . Root gravitropism and below-grown competition among neighbouring plants: a modeling approach JP Stanga , K Boonsirichai , JC Sedbrook , MS Otegui , PH Masson . A Role for the TOC complex in arabidopsis root gravitropism . Plant Physiol , 2009 . 149 ( 4 ): 1896 - 1905 . 19211693 DOI: 10.1104/pp.109.135301 http://doi.org/10.1104/pp.109.135301 . A Role for the TOC complex in arabidopsis root gravitropism S Vitha , LM Zhao , FD Sack . Interaction of root gravitropism and phototropism in Arabidopsis wild-type and starchless mutants . Plant Physiol , 2000 . 122 ( 2 ): 453 - 461 . 10677438 DOI: 10.1104/pp.122.2.453 http://doi.org/10.1104/pp.122.2.453 . Interaction of root gravitropism and phototropism in Arabidopsis wild-type and starchless mutants S Vitha , M Yang , FD Sack , JZ Kiss . Gravitropism in starch-excess mutant of Arabidopsis thaliana . Am J Bot , 2007 . 94 ( 4 ): 590 - 598 . DOI: 10.3732/ajb.94.4.590 http://doi.org/10.3732/ajb.94.4.590 . Gravitropism in starch-excess mutant of Arabidopsis thaliana H Wang , S Taketa , A Miyao , H Hirochika , M Ichii . Isolation of a novel lateral-rootless mutant in rice ( Oryza sativa L.) with reduced sensitivity to auxin . Plant Sci , 2006 . 170 ( 1 ): 70 - 77 . DOI: 10.1016/j.plantsci.2005.08.005 http://doi.org/10.1016/j.plantsci.2005.08.005 . Isolation of a novel lateral-rootless mutant in rice (Oryza sativa L.) with reduced sensitivity to auxin AK Wilson , FB Pickett , JC Turner , M Estelle . A dominant mutation in Arabidopsis confers resistance to auxin, ethylene and abscisic acid . Mol Gen Genet , 1990 . 222 ( 2-3 ): 377 - 383 . 2148800 DOI: 10.1007/BF00633843 http://doi.org/10.1007/BF00633843 . A dominant mutation in Arabidopsis confers resistance to auxin, ethylene and abscisic acid AW Woodward , B Bartel . Auxin: regulation, action, and interaction . Ann Bot , 2005 . 95 ( 5 ): 707 - 735 . 15749753 DOI: 10.1093/aob/mci083 http://doi.org/10.1093/aob/mci083 . Auxin: regulation, action, and interaction M Xu , L Zhu , HX Shou , P Wu . A PIN1 family gene, OsPIN1 , involved in auxin-dependent adventitious root emergence and tillering in rice . Plant Cell Physiol , 2005 . 46 ( 10 ): 1674 - 1681 . 16085936 DOI: 10.1093/pcp/pci183 http://doi.org/10.1093/pcp/pci183 . A PIN1 family gene, OsPIN1, involved in auxin-dependent adventitious root emergence and tillering in rice M Yamamoto , KT Yamamoto . Differential effects of 1-naphthaleneacetic acid, indole-3-acetic acid and 2,4-dichlorophenoxyacetic acid on the gravitropic response of roots in an auxin-resistant mutant of Arabidopsis , auxl . Plant Cell Physiol , 1998 . 39 ( 6 ): 660 - 664 . 9697346 . Differential effects of 1-naphthaleneacetic acid, indole-3-acetic acid and 2,4-dichlorophenoxyacetic acid on the gravitropic response of roots in an auxin-resistant mutant of Arabidopsis, auxl X Yang , S Lee , J So , N Dharmasiri , L Ge , C Jensen , R Hangarter , L Hobbie , M Estelle . The IAA1 protein is encoded by AXR5 and is a substrate of SCF TIR1 . Plant J , 2004 . 40 ( 5 ): 772 - 782 . 15546359 DOI: 10.1111/j.1365-313X.2004.02254.x http://doi.org/10.1111/j.1365-313X.2004.02254.x . The IAA1 protein is encoded by AXR5 and is a substrate of SCFTIR1 S Yoshida , DA Forno , JH Cock , 等 . Laboratory Manual for Physiological Studies of Rice , 1976 . 3rd Ed : Manila, the Philippines The International Rice Research Institute , 1 - 83 . . Laboratory Manual for Physiological Studies of Rice 10.1631/jzus.B0920132 Project supported by the High-Tech Research and Development Program (863) of China (No. 2006AA10Z175), and the Science and Research Foundation of the Bureau of Education of Zhejiang Province, China (No. 20070170) 2009-05-06 2009-09-10 2009-07-27 2022-01-05 Copyright © 2009, Journal of Zhejiang University Science 2009 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 10 10