Bone marrow mesenchymal stem cell transplantation combined with perindopril treatment attenuates infarction remodelling in a rat model of acute myocardial infarction

Bone marrow mesenchymal stem cell transplantation combined with perindopril treatment attenuates infarction remodelling in a rat model of acute myocardial infarction 1 first-author †E-mail:wang_jian_an@tom.com †E-mail:wang_jian_an@tom.com wang_jian_an@tom.com 2 2 2 2 2 2 2 Department of Cardiology, the Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009, China Department of Cardiology, the Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009, China Center of Lab, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou 310016, China Center of Lab, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou 310016, China Objective: 2 This study was performed to evaluate whether implantation of mesenchymal stem cell (MSC) would reduce left ventricular remodelling from the molecular mechanisms compared with angiotensin-converting enzyme inhibitors (ACEIs) perindopril into ischemic myocardium after acute myocardial infarction. Methods: 2 Forty rats were divided into four groups: control, MSC, ACEI, MSC+ACEI groups. Bone marrow stem cell derived rat was injected immediately into a zone made ischemic by coronary artery ligation in MSC group and MSC+ACEI group. Phosphate-buffered saline (PBS) was injected into control group. Perindopril was administered p.o. to ACEI group and MSC+ACEI group. Six weeks after implantation, the rats were killed and heart sample was collected. Fibrillar collagen was observed by meliorative Masson’s trichome stain. Western Blotting was employed to evaluate the protein expression of matrix metalloproteinase (MMP)-2, matrix metalloproteinase (MMP)-9 in infarction zone. The transcriptional level of MMP2, MMP9 and tissue inhibitor of matrix metalloproteinase (TIMP)-1 in infarction area was detected by reverse transcriptase PCR (RT-PCR) analysis. Results: 2 The fibrillar collagen area, the protein expression of MMP2, MMP9 and the transcriptional level of MMP2, MMP9 mRNA in infarction zone reduced in MSC group, ACEI group, and MSC+ACEI group. No significant difference was detected in the expression of TIMP1 mRNA among the 4 groups. Conclusion: 2 Both MSC and ACEI could reduce infarction remodelling by altering collagen metabolism. Remodelling Acute myocardial infarction Perindopril Bone marrow mesenchymal stem cell INTRODUCTION 1 Ventricular remodelling after acute myocardial infarction not only changes the topography including ventricular enlargement and lengthening of the noncontractile region, but also changes the microstructure’s myocardial apoptosis, myocardial hypertrophy, increasing content of collagen and expression of MMP (matrix metalloproteinase). This remodelling can lead to decline of ventricular function and adversely affect the prognosis for survival. Thus, reversing the procedure of ventricular remodelling would be desirable for the treatment of AMI (acute myocardial infarction). Activation of the circulating and tissue rennin-angiotensin-aldosterone system (RAAS) could lead to ventricular remodelling. The therapeutic use of ACEI (angiotensin-converting enzyme inhibitor) is beneficial for reducing ventricular remodelling. Optimization studies demonstrated that angiotensin-converting enzyme inhibitors attenuate ventricular remodelling after acute myocardial infarction (Møller et al., 2004 2004 ). MSCs (mesenchymal stem cells) are pluripotent stem cells within the marrow microenvironment (Pittenger et al., 1999 1999 ). Clinical studies showed that MSC significantly improved left ventricular function after intracoronary injection of patient with AMI (Strauer et al., 2001 2001 ). However, little information is available about the infarction remodelling after bone marrow mesenchymal stem cell transplantiation. The purpose of this study was to investigate: (1) whether transplantation of MSC could reduce the fibrillar collagen content, the expression of MMP as compared to treatment of ACEI; (2) whether transplantation of MSC could enhance the beneficial effect of ACEI in reducing ventricular remodelling. MATERIALS AND METHODS 1 Preparation of MSC 2 The experimental rats were anesthetized with intraperitoneal injection of 4% chloral hydrate solution (1 ml/100 g). Tibia and thigh bones were collected and pulverized, then transferred to a sterile tube and mixed with 5 ml phosphate-buffered saline (PBS) solution containing 7500 U heparin, then added into Dulbcco’s Modified Eagle Medium (DMEM). The tube was centrifuged at 900×g for 20 min. The cell suspension was loaded on Lympholyte solution. The cells were centrifuged at 900×g for 25 min. The middle one third of total volume were transferred into a tube containing DMEM, and centrifuged at 900×g for 25 min. The cell pellet was then resuspended in culture medium and seeded in culture flasks, and maintained at 37 °C in 5% CO 2 humidified air. After washing off the unattached cells during the period of 48 h, the adherent cells were cultured in DMEM containing 20% fetal bovine serum and antibiotics. The medium was changed once every 5 d. DAPI labelling 2 When MSCs completely occupied the flask bottom, they were incubated in medium containing DAPI (4′6-diamidino-2-phenylindole, 50 μg/ml, Sigma, USA) for 24 h. They removed from the culture bottles using 0.25% trypsin, neutralized with culture medium, and collected by centrifugation at 900×g for 5 min, and then suspended in PBS at concentration of 10 7 cells in 150 μl for transplantation. Experimental model 2 Forty adult male Sprague Dawley (SD) rats (200~260 g) were enrolled in. AMI model were made by ligation of the left anterior descending coronary artery. The rats were anesthetized with 4% chloral hydrate solution (1 ml/100 g) by intraperitoneal injection, then intubated with 18G tube, and put in room with air ventilated by using animal ventilator. A thoracotomy was performed, the left anterior descending artery was ligated. MSC implantation into ischemic myocardium 2 Forty rats were divided into four groups: control, MSC, ACEI, MSC+ACEI groups. PBS was injected into rat in control group and ACEI group. Perindopril was administered (p.o. 2 mg/(kg body weight)) to ACEI group, and MSC+ACEI group. PBS medium containing MSC (total 10 7 cells, 3 sites×0.05 ml per site) or medium alone was injected into the left anterior descending coronary artery risk area (ischemic border) with a 24-gauge needle. Six weeks after MSC implantation, the rats were killed and tissue samples from ischemic area were collected. Histology 2 Tissue samples from the infraction area were collected at 6 weeks after transplantation and fixed in 4% PBS formaldehyde for histological study. The samples were embedded and cut to yield 10-μm thick sections and stained with meliorative Masson’s trichome stain. Interstitial fibrosis was stained blue. Some samples were frozened and cut into 4-μm thick sections, then observed under the fluorescence microscopy. Western Blotting 2 Frozen hearts were crushed with a mortar and pestle, at liquid nitrogen temperature and homogenized by vibration in solution containing PMSF. The homogenate was centrifuged at 12000×g at 4 °C for 25 min, and the deposition was collected and stored at −80 °C. Eighty micrograms of protein from rat heart homogenate was denatured in boiling water for 5 min and added to 10% SDS-PAGE and then transferred to polyvinylidene difluoride membranes. Membranes were blocked overnight with 5% (w/v) dry milk solution containing 10 mmol/L Tri-Cl, pH 8.0, 150 mmol/L NaCl and 0.05% Tween 20 (TBST) before incubation with primary antibodies diluted in TBST (1:200 for MMP2 and MMP9; 1:1000 for β-actin). After washing, the membranes were incubated 1 h with secondary antibody diluted 1:5000 in TBST, and the labelled proteins were detected by using enhanced chemiluminescence reagents and exposed to film (Kodak, USA). RT-PCR 2 The frozen hearts were crushed with a mortar and pestle at liquid nitrogen temperature. Total RNA was extracted with Trizol reagent (Gibco, USA) according to the manufacturer’s instructions and quantitated by absorbance at 260 nm. The reaction volume of reverse transcription polymerase chain reaction was 25 μl. Reaction temperature was set at 42 °C for 30 min. The total reaction volume was 25 μl for PCR reaction. Primers sequences are shown in Table 1 1 . β-actin was used as the internal standard. PCR amplification was carried out in a volume of 25 μl containing 2 μl of the template, 2.5 μl PCR buffer (10×) and 0.2 μl Taq polymerase, 2.5 mmol/L of each dNTP (TaKaRa, 2.5 mmol/L), 1.5 μl MgCl 2 (25 mmol/L, promega), 1 μl Primers (10 μmol/L, forward and reverse each). Note: Cycling parameters: one cycle of 5 min at 95 °C; 32 cycles of 30 s at 95 °C, 30 s at 57~60 °C and 30 s at 72 °C; and a final extension at 72 °C for 7 min, then preserve at 4 °C Primer Direction Sequence (5′ to 3′) T m (°C) Size (bp) 2 MMP2 Forward AGGACAAGTGGTCCGCGTAAAG 59 510 Reverse CCACTTCCGGTCATCATCGTAGT 2 MMP9 Forward GGGAACGTATCTGGAAATTCG 57 520 Reverse CAGAACCGACCCTACAAAGTTG 2 TIMP1 Forward GACTAAGATGCTCAAAGGATTCG 58 360 Reverse ATCGCTCTGGTAGCCCTTCT 2 β-actin Forward ATATCGCTGCGCTCGTCGTC 58 760 Reverse GCATCGGAACCGCTCATTGC Detection of PCR products 2 Ten microlitres of each reaction product mixed with 2 μl of 6×loading buffer was fractionated on 1.7% agarose gel. DNA Marker DL2000 (TaKaRa 300 ng/5 μl). Statistical analysis 2 Numerical data were presented as mean± SD . Comparisons among groups were performed with one-way ANOVA and LSD comparison. Statistical significance was accepted while the null hypothesis was rejected at P < 0.05. RESULTS 1 Cultivated bone marrow mesenchymal stem cells were observed under phase contrast microscope. The cells displayed spindle-shape and adhered to the bottom of the flask (Fig. 1 1 ). DAPI-labeled (blue) label retaining cells were considered as the transplantation cells. Under the fluorescence microscopy, we observed that DAPI-labelled (blue) MSC was detected in the ischemic portion of the myocardium six weeks after mplantation (Fig. 2 2 ). Changes of collagen fibre in the myocardium 2 Masson’s trichrome staining revealed that collagen (blue) existed in the ischemic area (Fig. 3 3 ). The area of collagen was decreased in MSC+ACEI group (Fig. 3a 3a ), ACEI group (Fig. 3b 3b ), MSC group (Fig. 3c 3c ) compared with PBS group (Fig. 3d 3d ). MMP2 and MMP9 expression in the infraction area (Western Blotting) 2 MMP2 and MMP9 were highly expressed in the infraction area in the PBS group. The Western Blotting for MMP2 and MMP9 showed the band of 72 kDa and 92 kDa respectively. The band of 72 kDa was barely seen in the MSC+ACEI group. MMP2 expression was also reduced by the MSC and ACEI. MSC (Fig. 4 4 ), ACEI and MSC+ACEI lowered MMP9 expression. Lane 1: MSC+ACEI group; Lane 2: ACEI group; Lane 3: MSC group; Lane 4: Control group MMP2, MMP9 and TIMP1 expression in the infraction area (RT-PCR) 2 The PCR products of MMP2, MMP9 and TIMP1 were observed at the expected locations on agarose gels (Fig. 5 5 ). Statistical analysis indicated that the expression of MMP2, MMP9 mRNA in 3 treatment groups was significant different from that in the control group. In the MSC+ACEI, ACEI, MSC and PBS groups, the densitometry ratio of MMP2/β-actin was 0.43±0.20, 0.45±0.19, 0.46±0.14 and 0.78±0.22, respectively ( P < 0.05), the densitometry ratio of MMP9/β-actin was 0.40±0.13, 0.51±0.10, 0.48±0.09, and 0.70±0.20, respectively ( P < 0.05). However, no significant difference was detected in the expression of TIMP1 mRNA among the 4 groups (Table 2 2 ). M: DNA marker; Lane 1: MSC+ACEI group; Lane 2: ACEI group; Lane 3: MSC group; Lane 4: Control group MMP2/β-actin, P < 0.05 vs the PBS group MMP9/β-actin, P < 0.05 vs the PBS group MSC+ACEI ACEI MSC PBS MMP2/β-actin 0.43±0.20 * * 0.45±0.19 * * 0.46±0.14 * * 0.78±0.22 MMP9/β-actin 0.40±0.13 # # 0.51±0.10 # # 0.48±0.09 # # 0.70±0.20 TIMP1/β-actin 1.31±0.53 1.17±0.40 0.93±0.19 1.10±0.33 Both MSC and ACEI could lower MMP2 and MMP9 expression. DISCUSSION 1 Structural cardiac remodelling involves hypertrophy of the non-infarction area and lengthening of the infarction region after acute myocardial infarction. It has been suggested that alternation of fibrillar collagen content and activation of MMPs induce lengthening of the infarction region. In acute myocardial infarction patients, myocardial fibrillar collagen was degraded by matrix metalloproteinases. The level of MMP transcription may affect infracted area healing and LV (left ventricular) remodelling. If the fibrillar collagen increased, activation of MMP was increased, then lead to pathological left ventricular remodelling. Decrease of MMP activity may facilitate collagen accumulation. Myocardial MMP activation shows a time-dependent spectrum with the development of pressure-overload (Mujumdar and Tyagi, 1999 1999 ). Garcia et al.( 2005 2005 ) studied the relation between abnormal cell wall motion and stimulation of MMP in left ventricle by electric stimulates atrial and ventricular sites of five open-chest anesthetized dogs, and found that dyskinesia induced by epicardial activation stimulates MMP activity in the heart. MMPs play a pivotal role in tissue remodelling processes. MMP activity was upregulated during MI (myocardial infarction). This process was regulated by several cytokines. Cytokine tumor necrosis factor (TNF) alpha may relate to left ventricular remodelling. Yang and co-workers studied the changes of plasma levels of TNF alpha and matrix metalloproteinase-2,3,9 (MMP-2,3,9) expressions in myocardium of congestive heart failure (CHF) patients and found plasma levels of TNF alpha increased in patients with CHF. The expressions of MMP-2,3,9 were significantly increased in patients with CHF compare to controls. This effect support that TNF alpha might mediate the upregulation of MMP (Yang et al., 2004 2004 ). TNF alpha increased human atrial myofibroblast proliferation and MMP9 secretion predominantly via the TNF-R1 receptor (Porter et al., 2004 2004 ). Xie et al.( 2004 2004 )’s experimental research on regulation of MMP2 and MMP9 expression and activity in adult rat cardiac fibroblasts in response to interleukin-1 beta and demonstrated that activation of ERK1/2 and JNKs play a pivotal role in the regulation of MMP9 expression and activity; activation of NF-kappaB stimulates expression of MMP2 and MMP9. TIMP is an inhibitor of MMP. Four different TIMP species have been identified. TIMP binds to activated MMPs in 1:1 ratio (Spinale, 2002 2002 ). TIMP1 knock-out mice developed more large left ventricular end-diastolic volume and mass compare to wild-type mice. Whereas left ventricular systolic pressure and cardiac output were similar in both group. Myocardial fibrillar collagen content was reduced in TIMP1 knock-out mice (Roten et al., 2000 2000 ). In TIMP1-deficient mice, left ventricular remodelling process accelerated after myocardial infarction, which demonstrated that myocardial TIMP1 plays a regulatory role in post-MI remodelling (Ikonomidis et al., 2005 2005 ; Roten et al., 2000 2000 ). If MMP1 increased but TIMP1 did not, left ventricular dysfunction and dilatation would occur (Papadopoulos et al., 2005 2005 ). In spontaneously hypertensive rat model, it could be found that myocardial TIMP levels decreased while MMP activity increased in the process of decompensation to LV failure. Bone marrow contains hematopoietic stem cell and mesenchymal stem cell, with the latter having the capacity of self-renewal and differentiation into multiple lineages, whether MSC could differentiate into cardiac cell is still in controversy. Many experts consider that MSC would infuse into cardiac cell. Earlier studies showed that transplantation of MSC improves heart function (Chen et al., 2004 2004 ). However, little information is available on the effect of MSC on ventricular remodelling after acute myocardial infarction. Does MSC attenuate the degree of LV remodelling? If so, what is the underlying molecular mechanism of that process? Recent clinical and experimental studies imply MSC transplantation significantly improved left ventricular function after AMI. Our study tested the hypothesis that MSC attenuates the degree of LV remodelling by altering the expression of MMPs. Xu et al.( 2005 2005 ) reported that MSC transplantation in rats after myocardial infarction attenuates extracellular matrix (ECM) remodelling. In that study, they found that collagen type I, collagen type III, MMP1, TIMP1 mRNA expression were decreased by MSC transplantation, whereas no significant difference was observed for MMP1 between the MI group and the MI+MSC group. In our study, we focused on the change of infarction area and found that MMP2 and MMP9 upregulated in infarction area, probably through a paracrine-mediated mechanism (Fedak et al., 2005 2005 ). Fedak transplanted smooth muscle cells to the dilating left ventricle of cardiomyopathic hamsters, and found that left ventricular dilatation was attenuated and TIMP:MMP ratio was increased in the transplantion group, as compared to the control group. This phenomenon indicates that cell transplantion might reduce the capacity for matrix degradation. The therapeutic use of ACEI is beneficial for reducing ventricular remodelling. Early initiation of ACEIs attenuates collagenolytic activity (Papadopoulos et al., 2004 2004 ). ACEI also reduced cardiac remodelling in end stage heart failure, the ACE inhibitors captopril and ramipril inhibited MMP2 and MMP9 activities (Reinhardt et al., 2002 2002 ). Our data are consistent with previous viewpoint. The main evidence of this study is that the mRNA and protein expression of the MMP2 and MMP9 is significantly decreased in group MSC or ACEI. But there was no difference in TIMP1 among the 4 groups. One possible interpretation of this finding was that MMPs are mainly regulated by cytokine. Our present study demonstrated the following effects of MSC transplantation in a rat model of AMI: (1) decrease in collagen in the infarction area of the myocardium; (2) decreased MMP2 and MMP9 level in the myocardium. The beneficial effect of MSC transplantation on reducing ventricular remodelling is mediated by a decrease in MMPs expression. In summary, we have demonstrated that mesenchymal stem cell transplantation could reduce the collagen fibre in the myocardium and MMP2, MMP9 in infarction zone. References SL Chen , WW Fang , F Ye , YH Liu , J Qian , SJ Shan , JJ Zhang , RZ Chunhua , LM Liao , S Lin , 等 . Effect on left ventricular function of intracoronary transplantation of autologous bone marrow mesenchymal stem cell in patients with acute myocardial infarction . Am J Cardiol , 2004 . 94 ( 1 ): 92 - 95 . 15219514 DOI: 10.1016/j.amjcard.2004.03.034 http://doi.org/10.1016/j.amjcard.2004.03.034 . Effect on left ventricular function of intracoronary transplantation of autologous bone marrow mesenchymal stem cell in patients with acute myocardial infarction PW Fedak , PE Szmitko , RD Weisel , SM Altamentova , N Nili , N Ohno , S Verma , S Fazel , BH Strauss , RK Li . Cell transplantation preserves matrix homeostasis: a novel paracrine mechanism . Virchows Arch , 2005 . 14 1 - 11 . . Cell transplantation preserves matrix homeostasis: a novel paracrine mechanism RA Garcia , KL Brown , RS Pavelec , KV Go , JW Covell , FJ Villarreal . Abnormal cardiac wall motion and early matrix metalloproteinase activity . Am J Physiol Heart Circ Physiol , 2005 . 288 ( 3 ): H1080 - H1087 . 15486029 DOI: 10.1152/ajpheart.00860.2004 http://doi.org/10.1152/ajpheart.00860.2004 . Abnormal cardiac wall motion and early matrix metalloproteinase activity JS Ikonomidis , JW Hendrick , AM Parkhurst , AR Herron , PG Escobar , KB Dowdy , RE Stroud , E Hapke , MR Zile , FG Spinale . Accelerated LV remodelling after myocardial infarction in TIMP-1-deficient mice: effects of exogenous MMP inhibition . Am J Physiol Heart Circ Physiol , 2005 . 288 ( 1 ): H149 - H158 . 15598866 DOI: 10.1152/ajpheart.00370.2004 http://doi.org/10.1152/ajpheart.00370.2004 . Accelerated LV remodelling after myocardial infarction in TIMP-1-deficient mice: effects of exogenous MMP inhibition JE Møller , U Dahlstrom , O Gotzsche , A Lahiri , K Skagen , GS Andersen , K Egstrup . OPTIMAAL study group effects of losartan and captopril on left ventricular systolic and diastolic function after acute myocardial infarction: results of the optimal trial in myocardial infarction with angiotensin II antagonist losartan (OPTIMAAL) echocardiographic substudy . Am Heart J , 2004 . 147 ( 3 ): 494 - 501 . 14999200 DOI: 10.1016/j.ahj.2003.10.031 http://doi.org/10.1016/j.ahj.2003.10.031 . OPTIMAAL study group effects of losartan and captopril on left ventricular systolic and diastolic function after acute myocardial infarction: results of the optimal trial in myocardial infarction with angiotensin II antagonist losartan (OPTIMAAL) echocardiographic substudy VS Mujumdar , SC Tyagi . Temporal regulation of extracellular matrix components in transition from compensatory hypertrophy to decompensatory heart failure . J Hypertens , 1999 . 17 261 - 270 . 10067796 . Temporal regulation of extracellular matrix components in transition from compensatory hypertrophy to decompensatory heart failure DP Papadopoulos , EV Economou , TK Makris , KJ Kapetanios , I Moyssakis , VE Votteas , PK Toutouzas . Effect of angiotensin-converting enzyme inhibitor on collagenolytic enzyme activity in patients with acute myocardial infarction . Drugs Exp Clin Res , 2004 . 30 ( 2 ): 55 - 65 . 15272643 . Effect of angiotensin-converting enzyme inhibitor on collagenolytic enzyme activity in patients with acute myocardial infarction DP Papadopoulos , I Moyssakis , TK Makris , M Poulakou , G Stavroulakis , D Perrea , VE Votteas . Clinical significance of matrix metalloproteinases activity in acute myocardial infarction . Eur Cytokine Netw , 2005 . 16 ( 2 ): 152 - 160 . 15941687 . Clinical significance of matrix metalloproteinases activity in acute myocardial infarction MF Pittenger , AM Mackay , SC Beck , RK Jaiswal , R Dougls , JD Mosca , MA Moorman , DW Simonetti , S Craig , DR Marshak . Multilineage potential of adult human mesenchymal stem cells . Science , 1999 . 284 ( 5411 ): 143 - 147 . 10102814 DOI: 10.1126/science.284.5411.143 http://doi.org/10.1126/science.284.5411.143 . Multilineage potential of adult human mesenchymal stem cells KE Porter , NA Turner , DJ O′Regan , SG Ball . Tumor necrosis factor alpha induces human atrial myofibroblast proliferation, invasion and MMP-9 secretion: inhibition by simvastatin . Cardiovasc Res , 2004 . 64 ( 3 ): 507 - 515 . 15537504 DOI: 10.1016/j.cardiores.2004.07.020 http://doi.org/10.1016/j.cardiores.2004.07.020 . Tumor necrosis factor alpha induces human atrial myofibroblast proliferation, invasion and MMP-9 secretion: inhibition by simvastatin D Reinhardt , HH Sigusch , J Hensse , SC Tyagi , R Korfer , HR Figulla . Cardiac remodelling in end stage heart failure: upregulation of matrix metalloproteinase (MMP) irrespective of the underlying disease, and evidence for a direct inhibitory effect of ACE inhibitors on MMP . Heart , 2002 . 88 ( 5 ): 525 - 530 . 12381651 DOI: 10.1136/heart.88.5.525 http://doi.org/10.1136/heart.88.5.525 . Cardiac remodelling in end stage heart failure: upregulation of matrix metalloproteinase (MMP) irrespective of the underlying disease, and evidence for a direct inhibitory effect of ACE inhibitors on MMP L Roten , S Nemoto , J Simsic , ML Coker , V Rao , S Baicu , G Defreyte , PJ Soloway , MR Zile , FG Spinalefl . Effects of gene deletion of the tissue inhibitor of the matrix metalloproteinase-type 1 (TIMP-1) on left ventricular geometry and function in mice . J Mol Cell Cardiol , 2000 . 32 ( 1 ): 109 - 120 . 10652195 DOI: 10.1006/jmcc.1999.1052 http://doi.org/10.1006/jmcc.1999.1052 . Effects of gene deletion of the tissue inhibitor of the matrix metalloproteinase-type 1 (TIMP-1) on left ventricular geometry and function in mice FG Spinale . Matrix metalloproteinases regulation and dysregulation in the failing heart . Circ Res , 2002 . 90 ( 5 ): 520 - 530 . 11909815 DOI: 10.1161/01.RES.0000013290.12884.A3 http://doi.org/10.1161/01.RES.0000013290.12884.A3 . Matrix metalloproteinases regulation and dysregulation in the failing heart BE Strauer , M Brehm , T Zeus , N Gattermann , A Hernandez , RV Sorg , G Kogler , P Wernet . Intracoronary, human autologus stem cell transplantation for myocardial regeneration following myocardial infarction . Dtsch Med Wochenschr , 2001 . 126 ( 34-35 ): 932 - 938 . (in German) 11523014 DOI: 10.1055/s-2001-16579-1 http://doi.org/10.1055/s-2001-16579-1 . Intracoronary, human autologus stem cell transplantation for myocardial regeneration following myocardial infarction Z Xie , M Singh , K Singh . Differential regulation of matrix metalloproteinase-2 and -9 expression and activity in adult rat cardiac fibroblasts in response to interleukin-1 beta . J Biol Chem , 2004 . 279 ( 38 ): 39513 - 39519 . 15269222 DOI: 10.1074/jbc.M405844200 http://doi.org/10.1074/jbc.M405844200 . Differential regulation of matrix metalloproteinase-2 and -9 expression and activity in adult rat cardiac fibroblasts in response to interleukin-1 beta X Xu , Z Xu , Y Xu , G Cui . Effects of mesenchymal stem cell transplantation on extracellular matrix after myocardial infarction in rats . Coron Artery Dis , 2005 . 16 ( 4 ): 245 - 255 . 15915077 DOI: 10.1097/00019501-200506000-00006 http://doi.org/10.1097/00019501-200506000-00006 . Effects of mesenchymal stem cell transplantation on extracellular matrix after myocardial infarction in rats LX Yang , SJ Zhu , YJ Yang , CM Guo , F Qi , L Wei , YK Shi , Y Wang , L Ren . Tumor necrosis factor alpha and myocardial matrix metalloproteinases in left ventricular remodelling . Chinese Journal of Internal Medicine , 2004 . 43 ( 11 ): 828 - 831 . (in Chinese) . Tumor necrosis factor alpha and myocardial matrix metalloproteinases in left ventricular remodelling Thanks are due to my teacher Zhu You-fa for his helpful collaboration. 10.1631/jzus.2006.B0641 2006-03-02 2006-05-29 2006-07-14 2022-01-05 Copyright © 2006, Journal of Zhejiang University Science 2006 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 08 07